Transcript: Mouse NM_018782.2

Mus musculus calcitonin receptor-like (Calcrl), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Calcrl (54598)
Length:
4761
CDS:
518..1909

Additional Resources:

NCBI RefSeq record:
NM_018782.2
NBCI Gene record:
Calcrl (54598)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221805 GCTTGTATTACAACGACAATT pLKO.1 1338 CDS 100% 13.200 18.480 N Calcrl n/a
2 TRCN0000319850 GCTTGTATTACAACGACAATT pLKO_005 1338 CDS 100% 13.200 18.480 N Calcrl n/a
3 TRCN0000221807 CCAACGGATCACATTGCATAA pLKO.1 1027 CDS 100% 10.800 15.120 N Calcrl n/a
4 TRCN0000319921 CCAACGGATCACATTGCATAA pLKO_005 1027 CDS 100% 10.800 15.120 N Calcrl n/a
5 TRCN0000221804 GCCCTGAATCTGTTCTACCTA pLKO.1 926 CDS 100% 3.000 2.400 N Calcrl n/a
6 TRCN0000319849 GCCCTGAATCTGTTCTACCTA pLKO_005 926 CDS 100% 3.000 2.400 N Calcrl n/a
7 TRCN0000221806 GCCTCTTAATATGGCTCTCAT pLKO.1 556 CDS 100% 4.950 3.465 N Calcrl n/a
8 TRCN0000221803 CCCTCAAATGAAATGGGAATT pLKO.1 2001 3UTR 100% 0.000 0.000 N Calcrl n/a
9 TRCN0000319851 CCCTCAAATGAAATGGGAATT pLKO_005 2001 3UTR 100% 0.000 0.000 N Calcrl n/a
10 TRCN0000008169 GCTCAATATGAATGTTACCAA pLKO.1 644 CDS 100% 3.000 2.100 N CALCRL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488244 GTTTCTTGTTAGTCGACGTTCTAC pLX_317 19.7% 83% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV