Transcript: Mouse NM_018799.2

Mus musculus eukaryotic translation initiation factor 3, subunit I (Eif3i), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eif3i (54709)
Length:
1127
CDS:
53..1030

Additional Resources:

NCBI RefSeq record:
NM_018799.2
NBCI Gene record:
Eif3i (54709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123499 GCGGTCCATCACGCAGATCAA pLKO.1 82 CDS 100% 1.650 2.310 N Eif3i n/a
2 TRCN0000335769 GCGGTCCATCACGCAGATCAA pLKO_005 82 CDS 100% 1.650 2.310 N Eif3i n/a
3 TRCN0000123502 CAACGTGTGGTACTCTGTCAA pLKO.1 154 CDS 100% 4.950 3.960 N Eif3i n/a
4 TRCN0000335770 CAACGTGTGGTACTCTGTCAA pLKO_005 154 CDS 100% 4.950 3.960 N Eif3i n/a
5 TRCN0000375852 GCGAAGGAGACCTTCTCTTCA pLKO_005 111 CDS 100% 4.950 3.960 N Eif3i n/a
6 TRCN0000123501 CGACTCTTGAACATCAGAAGA pLKO.1 705 CDS 100% 4.950 3.465 N Eif3i n/a
7 TRCN0000335693 CGACTCTTGAACATCAGAAGA pLKO_005 705 CDS 100% 4.950 3.465 N Eif3i n/a
8 TRCN0000363891 AGAGGTGTTGGTGAACGTAAA pLKO_005 586 CDS 100% 10.800 6.480 N Eif3i n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01986 pDONR223 100% 91.2% 99.3% None (many diffs) n/a
2 ccsbBroad304_01986 pLX_304 0% 91.2% 99.3% V5 (many diffs) n/a
3 TRCN0000480882 CACTTCCCTCACCCACATTGCCAG pLX_317 48% 91.2% 99.3% V5 (many diffs) n/a
Download CSV