Transcript: Mouse NM_018804.3

Mus musculus synaptotagmin XI (Syt11), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Syt11 (229521)
Length:
4585
CDS:
276..1568

Additional Resources:

NCBI RefSeq record:
NM_018804.3
NBCI Gene record:
Syt11 (229521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381550 TCACCGGTCTCTCAGGTAATC pLKO_005 1240 CDS 100% 10.800 15.120 N Syt11 n/a
2 TRCN0000093553 CCATGTAAAGAAGTGCACTTT pLKO.1 1316 CDS 100% 4.950 6.930 N Syt11 n/a
3 TRCN0000381801 ACAGTCTGAGCGAGTACTAAC pLKO_005 1549 CDS 100% 10.800 8.640 N Syt11 n/a
4 TRCN0000093550 CCGCCATACAAGTTCATTCAT pLKO.1 426 CDS 100% 5.625 4.500 N Syt11 n/a
5 TRCN0000381689 ATCAGGCTTCTCTGGGTTATT pLKO_005 1949 3UTR 100% 13.200 9.240 N Syt11 n/a
6 TRCN0000380886 CACCGACCTTCTGCCTGATAT pLKO_005 1376 CDS 100% 13.200 9.240 N Syt11 n/a
7 TRCN0000093551 GCCATACAAGTTCATTCATAT pLKO.1 428 CDS 100% 13.200 9.240 N Syt11 n/a
8 TRCN0000093549 CCCTGAAATTGGCCTCTCTTT pLKO.1 1928 3UTR 100% 4.950 3.465 N Syt11 n/a
9 TRCN0000093552 GCATCTTGTATGGACCAGTTA pLKO.1 618 CDS 100% 4.950 3.465 N Syt11 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2646 3UTR 100% 4.950 2.475 Y Gad2 n/a
11 TRCN0000382480 ACAGTCTGAGCGAGTACTAAT pLKO_005 1549 CDS 100% 13.200 10.560 N SYT11 n/a
12 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2587 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07855 pDONR223 100% 89.8% 95.1% None (many diffs) n/a
2 ccsbBroad304_07855 pLX_304 0% 89.8% 95.1% V5 (many diffs) n/a
3 TRCN0000480526 GTTCGGGAATATTTCGAACATATA pLX_317 27.9% 89.8% 95.1% V5 (many diffs) n/a
4 ccsbBroadEn_10455 pDONR223 100% 89.8% 95.1% None (many diffs) n/a
5 ccsbBroad304_10455 pLX_304 0% 89.8% 95.1% V5 (many diffs) n/a
6 TRCN0000479218 CCCCCAAGGATTTAACAAATGCCT pLX_317 34.1% 89.8% 95.1% V5 (many diffs) n/a
Download CSV