Transcript: Human NM_019003.4

Homo sapiens spindlin family member 2A (SPIN2A), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SPIN2A (54466)
Length:
1319
CDS:
372..1148

Additional Resources:

NCBI RefSeq record:
NM_019003.4
NBCI Gene record:
SPIN2A (54466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019003.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423143 GGAGTTGTAGATGGCCTAATA pLKO_005 981 CDS 100% 13.200 6.600 Y SPIN2A n/a
2 TRCN0000433148 AGTCCTAACTGTTAGGGTAAA pLKO_005 1141 CDS 100% 10.800 5.400 Y SPIN2A n/a
3 TRCN0000161901 GCACATGTGTGGAAACAAATG pLKO.1 1167 3UTR 100% 10.800 5.400 Y SPIN2B n/a
4 TRCN0000418674 GGGTCTGCAAACATGACAAAG pLKO_005 438 CDS 100% 10.800 5.400 Y SPIN2A n/a
5 TRCN0000158461 CACATGTGTGGAAACAAATGT pLKO.1 1168 3UTR 100% 5.625 2.813 Y SPIN2B n/a
6 TRCN0000062703 CATGTGTGGAAACAAATGTAT pLKO.1 1170 3UTR 100% 5.625 2.813 Y SPIN2A n/a
7 TRCN0000160056 CATGTGTGGAAACAAATGTAT pLKO.1 1170 3UTR 100% 5.625 2.813 Y SPIN2B n/a
8 TRCN0000062704 CCCTCTCTTTATCTGGTGAAA pLKO.1 609 CDS 100% 4.950 2.475 Y SPIN2A n/a
9 TRCN0000062706 CCTATCATGAAAGCCTGGTTT pLKO.1 837 CDS 100% 4.950 2.475 Y SPIN2A n/a
10 TRCN0000165096 CTGGGTCTGCAAACATGACAA pLKO.1 436 CDS 100% 4.950 2.475 Y SPIN2B n/a
11 TRCN0000158702 GCATCATCTCACATTAGTGAT pLKO.1 714 CDS 100% 4.950 2.475 Y SPIN2B n/a
12 TRCN0000062705 GCAAATACCATAATTGGCAAA pLKO.1 744 CDS 100% 4.050 2.025 Y SPIN2A n/a
13 TRCN0000062707 CACATTAGTGATGCCAACCTT pLKO.1 723 CDS 100% 3.000 1.500 Y SPIN2A n/a
14 TRCN0000161329 GCTGCAGAATTTCTCATGGAT pLKO.1 523 CDS 100% 3.000 1.500 Y SPIN2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019003.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05691 pDONR223 100% 99.7% 99.6% None 405C>T;700A>G n/a
2 ccsbBroad304_05691 pLX_304 0% 99.7% 99.6% V5 405C>T;700A>G n/a
3 TRCN0000471674 AACTTGCTACCGGAACGACTTCAT pLX_317 50.1% 99.7% 99.6% V5 405C>T;700A>G n/a
4 ccsbBroadEn_08380 pDONR223 100% 99.6% 99.6% None 118C>A;132G>A;136C>T n/a
5 ccsbBroad304_08380 pLX_304 0% 99.6% 99.6% V5 118C>A;132G>A;136C>T n/a
6 TRCN0000468578 AGTACGTTCTATCTCATTAAGTTA pLX_317 50.1% 99.6% 99.6% V5 118C>A;132G>A;136C>T n/a
Download CSV