Transcript: Mouse NM_019431.2

Mus musculus calcium channel, voltage-dependent, gamma subunit 4 (Cacng4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cacng4 (54377)
Length:
984
CDS:
1..984

Additional Resources:

NCBI RefSeq record:
NM_019431.2
NBCI Gene record:
Cacng4 (54377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069272 GTTTAAGACCAAGCGGGAGTT pLKO.1 642 CDS 100% 4.050 5.670 N Cacng4 n/a
2 TRCN0000069270 GTTGCATCGAAGGCATCTATA pLKO.1 209 CDS 100% 13.200 10.560 N Cacng4 n/a
3 TRCN0000069268 CCTCAGTAATATCATCGGTAT pLKO.1 447 CDS 100% 4.050 3.240 N Cacng4 n/a
4 TRCN0000045151 CATCGGTATCATCGTCTACAT pLKO.1 459 CDS 100% 4.950 3.465 N CACNG4 n/a
5 TRCN0000069271 CCTGAAGATCACCGGAGCCAT pLKO.1 786 CDS 100% 0.880 0.616 N Cacng4 n/a
6 TRCN0000069269 CCTGGCTGTAAACATTTACAT pLKO.1 600 CDS 100% 0.563 0.394 N Cacng4 n/a
7 TRCN0000294472 GTCCTGGCTGTAAACATTTAC pLKO_005 598 CDS 100% 13.200 7.920 N CACNG4 n/a
8 TRCN0000045150 GAGTTGAGGTTTAAGACCAAA pLKO.1 634 CDS 100% 4.950 3.465 N CACNG4 n/a
9 TRCN0000287020 GAGTTGAGGTTTAAGACCAAA pLKO_005 634 CDS 100% 4.950 3.465 N CACNG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08052 pDONR223 100% 92.2% 98.1% None (many diffs) n/a
2 ccsbBroad304_08052 pLX_304 0% 92.2% 98.1% V5 (many diffs) n/a
3 TRCN0000479934 CGCCCACCCGAAACGGTCGTTTTC pLX_317 43% 92.2% 98.1% V5 (many diffs) n/a
Download CSV