Transcript: Mouse NM_019467.2

Mus musculus allograft inflammatory factor 1 (Aif1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Aif1 (11629)
Length:
875
CDS:
315..758

Additional Resources:

NCBI RefSeq record:
NM_019467.2
NBCI Gene record:
Aif1 (11629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088446 CAATTCCTCGATGATCCCAAA pLKO.1 402 CDS 100% 4.050 5.670 N Aif1 n/a
2 TRCN0000088444 CCTAGAGCTGAAGAGATTAAT pLKO.1 563 CDS 100% 15.000 10.500 N Aif1 n/a
3 TRCN0000088445 CTTGAGAATGATTCTGATGTA pLKO.1 665 CDS 100% 4.950 3.465 N Aif1 n/a
4 TRCN0000088447 GACGTTCAGCTACTCTGACTT pLKO.1 611 CDS 100% 4.950 3.465 N Aif1 n/a
5 TRCN0000088443 CAAGGTGAAGTACATGGAGTT pLKO.1 464 CDS 100% 4.050 2.835 N Aif1 n/a
6 TRCN0000029733 CCAGCCAAGAAAGCTATCTCT pLKO.1 726 CDS 100% 3.000 2.100 N AIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00043 pDONR223 100% 89.1% 89.1% None (many diffs) n/a
2 ccsbBroad304_00043 pLX_304 0% 89.1% 89.1% V5 (many diffs) n/a
3 TRCN0000473009 AACGTATCCTATGGGACCTCAGTG pLX_317 100% 89.1% 89.1% V5 (many diffs) n/a
Download CSV