Transcript: Mouse NM_019474.2

Mus musculus olfactory receptor 156 (Olfr156), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Olfr156 (29846)
Length:
1099
CDS:
75..1031

Additional Resources:

NCBI RefSeq record:
NM_019474.2
NBCI Gene record:
Olfr156 (29846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185913 CAAACAGGATGTTTCAGACAA pLKO.1 887 CDS 100% 4.950 3.465 N Olfr156 n/a
2 TRCN0000188788 GATCACCCAAAGCTGGAGAAA pLKO.1 129 CDS 100% 4.950 3.465 N Olfr156 n/a
3 TRCN0000203428 CATCTTTGTCTCCTACATCTT pLKO.1 713 CDS 100% 4.950 2.475 Y Olfr159 n/a
4 TRCN0000188465 CCTGAGGAACAAGGATGTGAA pLKO.1 965 CDS 100% 4.950 2.475 Y Olfr156 n/a
5 TRCN0000203152 GTTCATCTTTGTCTCCTACAT pLKO.1 710 CDS 100% 4.950 2.475 Y Olfr156 n/a
6 TRCN0000187286 CGTGCAGATGTTTCTCTCCTT pLKO.1 368 CDS 100% 2.640 1.320 Y Olfr155 n/a
7 TRCN0000185843 GACAATGTCATCAATCACTTT pLKO.1 585 CDS 100% 4.950 2.475 Y Olfr159 n/a
8 TRCN0000188297 CGCCCATGTACTTCTTCCTAA pLKO.1 244 CDS 100% 4.950 2.475 Y Olfr281 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.