Transcript: Mouse NM_019510.2

Mus musculus transient receptor potential cation channel, subfamily C, member 3 (Trpc3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Trpc3 (22065)
Length:
3694
CDS:
189..2921

Additional Resources:

NCBI RefSeq record:
NM_019510.2
NBCI Gene record:
Trpc3 (22065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068305 CCACTCAAGGTCTAGGATCAA pLKO.1 1001 CDS 100% 4.950 6.930 N Trpc3 n/a
2 TRCN0000068303 CCCTACCTTTATCATGCGAAA pLKO.1 3022 3UTR 100% 4.050 5.670 N Trpc3 n/a
3 TRCN0000068304 GCTGCCAAACATCACTGTTAT pLKO.1 1613 CDS 100% 13.200 9.240 N Trpc3 n/a
4 TRCN0000422735 TCGTGTCAAACTTGCCATTAA pLKO_005 1295 CDS 100% 13.200 9.240 N Trpc3 n/a
5 TRCN0000418748 CTCAATCAGCCAACACGATAT pLKO_005 2679 CDS 100% 10.800 7.560 N Trpc3 n/a
6 TRCN0000414421 GATATCTCCAGCCTTCGTTAT pLKO_005 2802 CDS 100% 10.800 7.560 N Trpc3 n/a
7 TRCN0000068307 GCTATGTTCTTTATGGGATAT pLKO.1 2314 CDS 100% 10.800 7.560 N Trpc3 n/a
8 TRCN0000044029 CCAGCCTTCGTTATGAACTTT pLKO.1 2809 CDS 100% 5.625 3.938 N TRPC3 n/a
9 TRCN0000068306 GCTATTGGATTGCACCTTGTA pLKO.1 1471 CDS 100% 4.950 2.970 N Trpc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01714 pDONR223 100% 81.7% 89.3% None (many diffs) n/a
2 ccsbBroad304_01714 pLX_304 0% 81.7% 89.3% V5 (many diffs) n/a
3 TRCN0000476794 TATTATCTAGGACCGGTGTACCTC pLX_317 16.4% 81.7% 89.3% V5 (many diffs) n/a
Download CSV