Transcript: Human NM_019555.3

Homo sapiens Rho guanine nucleotide exchange factor 3 (ARHGEF3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARHGEF3 (50650)
Length:
3582
CDS:
152..1732

Additional Resources:

NCBI RefSeq record:
NM_019555.3
NBCI Gene record:
ARHGEF3 (50650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412805 CTATTACCCTGTGTTGTATTT pLKO_005 1930 3UTR 100% 13.200 18.480 N ARHGEF3 n/a
2 TRCN0000047543 GCCTAGTAATAAACGGGTCAA pLKO.1 250 CDS 100% 4.050 5.670 N ARHGEF3 n/a
3 TRCN0000430081 GAATCTGAATGCCGCTATTAT pLKO_005 1070 CDS 100% 15.000 10.500 N ARHGEF3 n/a
4 TRCN0000437024 CCCTCTGCTTCTCCGAGAAAT pLKO_005 949 CDS 100% 13.200 9.240 N ARHGEF3 n/a
5 TRCN0000047547 CCCATGCTGAAACTCTCCATA pLKO.1 602 CDS 100% 4.950 3.465 N ARHGEF3 n/a
6 TRCN0000047546 CGCAAACTAGATCTCTGGAAT pLKO.1 893 CDS 100% 4.950 3.465 N ARHGEF3 n/a
7 TRCN0000047545 GCGATCTTTGAGCTTTCCCAA pLKO.1 527 CDS 100% 2.640 1.848 N ARHGEF3 n/a
8 TRCN0000047544 CGGCTTCTTTACTTGGAAGAA pLKO.1 1097 CDS 100% 0.495 0.347 N ARHGEF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03149 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03149 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476018 ACGGCTAGCTGTTATCGGGTACTC pLX_317 24.4% 100% 100% V5 n/a
4 ccsbBroadEn_11925 pDONR223 100% 61.2% 61% None 1_609delinsA;611_612insAA;1003T>G n/a
5 ccsbBroad304_11925 pLX_304 0% 61.2% 61% V5 1_609delinsA;611_612insAA;1003T>G n/a
6 TRCN0000474076 TTTTGCCACTACTCGGCCACGTTG pLX_317 39.2% 61.2% 61% V5 1_609delinsA;611_612insAA;1003T>G n/a
Download CSV