Transcript: Human NM_019610.5

Homo sapiens RBMX like 1 (RBMXL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
RBMXL1 (494115)
Length:
5028
CDS:
617..1789

Additional Resources:

NCBI RefSeq record:
NM_019610.5
NBCI Gene record:
RBMXL1 (494115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019610.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179861 CCTCCCACAATAAGACCATTT pLKO.1 2405 3UTR 100% 10.800 7.560 N KYAT3 n/a
2 TRCN0000034711 TGACTATCCATCAAGAGGCTA pLKO.1 1375 CDS 100% 2.640 1.584 N RBMXL1 n/a
3 TRCN0000180980 CACCACCACCACGAGATTATA pLKO.1 1320 CDS 100% 15.000 7.500 Y KYAT3 n/a
4 TRCN0000034710 CCTCTCGTAGAGATGTTTATT pLKO.1 1215 CDS 100% 15.000 7.500 Y RBMXL1 n/a
5 TRCN0000313999 AGATTATACTTACCGTGATTA pLKO_005 1333 CDS 100% 13.200 6.600 Y Rbmxl1 n/a
6 TRCN0000330771 ATGGTCGTGATCGTGACTATT pLKO_005 1413 CDS 100% 13.200 6.600 Y RBMX n/a
7 TRCN0000330770 GATGATGGGTATTCTACTAAA pLKO_005 1247 CDS 100% 13.200 6.600 Y RBMX n/a
8 TRCN0000330769 TCACGTGGAAGAGATAGTTAT pLKO_005 1166 CDS 100% 13.200 6.600 Y RBMX n/a
9 TRCN0000330768 CTATGTAAGGAAAGTGCTATT pLKO_005 2292 3UTR 100% 10.800 5.400 Y RBMX n/a
10 TRCN0000034713 GCTCTTCATTGGTGGGCTTAA pLKO.1 643 CDS 100% 10.800 5.400 Y RBMXL1 n/a
11 TRCN0000034712 CCACCAAACCATCATTTGAAA pLKO.1 867 CDS 100% 5.625 2.813 Y RBMXL1 n/a
12 TRCN0000034709 GCCGAAGTGATCTCTACTCAA pLKO.1 1605 CDS 100% 4.950 2.475 Y RBMXL1 n/a
13 TRCN0000072673 GCCTATGTAAGGAAAGTGCTA pLKO.1 2290 3UTR 100% 2.640 1.320 Y RBMX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019610.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03028 pDONR223 100% 97% 95.1% None (many diffs) n/a
2 ccsbBroad304_03028 pLX_304 0% 97% 95.1% V5 (many diffs) n/a
3 TRCN0000465341 TGGATACTAGCATGCCCCTATGTG pLX_317 32.8% 97% 95.1% V5 (many diffs) n/a
Download CSV