Construct: ORF TRCN0000465341
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007956.1_s317c1
- Derived from:
- ccsbBroadEn_03028
- DNA Barcode:
- TGGATACTAGCATGCCCCTATGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBMX (27316)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465341
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27316 | RBMX | RNA binding motif protein X... | NM_002139.4 | 100% | 100% | |
2 | human | 494115 | RBMXL1 | RBMX like 1 | NM_001162536.3 | 97% | 95.1% | (many diffs) |
3 | human | 494115 | RBMXL1 | RBMX like 1 | NM_019610.5 | 97% | 95.1% | (many diffs) |
4 | human | 27316 | RBMX | RNA binding motif protein X... | NR_028477.1 | 55% | 1_210del;318_352del;1419_2132del | |
5 | human | 27316 | RBMX | RNA binding motif protein X... | NM_001164803.2 | 49% | 18.2% | (many diffs) |
6 | human | 27316 | RBMX | RNA binding motif protein X... | NR_028476.1 | 47.7% | 1_210del;425_426ins172;1212_1925del | |
7 | mouse | 19655 | Rbmx | RNA binding motif protein, ... | NM_001166623.1 | 93.3% | 98.7% | (many diffs) |
8 | mouse | 19655 | Rbmx | RNA binding motif protein, ... | NM_011252.4 | 93.3% | 98.7% | (many diffs) |
9 | mouse | 19656 | Rbmxl1 | RNA binding motif protein, ... | NM_001252089.1 | 91.3% | 97.6% | (many diffs) |
10 | mouse | 19656 | Rbmxl1 | RNA binding motif protein, ... | NM_009033.2 | 91.3% | 97.6% | (many diffs) |
11 | mouse | 19656 | Rbmxl1 | RNA binding motif protein, ... | XM_006530775.2 | 91.3% | 97.6% | (many diffs) |
12 | mouse | 19656 | Rbmxl1 | RNA binding motif protein, ... | XM_006530776.2 | 91.3% | 97.6% | (many diffs) |
13 | mouse | 19655 | Rbmx | RNA binding motif protein, ... | NR_029425.1 | 41.7% | (many diffs) | |
14 | mouse | 19655 | Rbmx | RNA binding motif protein, ... | XR_878098.2 | 30.1% | (many diffs) | |
15 | mouse | 19655 | Rbmx | RNA binding motif protein, ... | XR_878097.2 | 30% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1239
- ORF length:
- 1173
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tgaagcagat cgcccaggaa agctcttcat tggtgggctt aatacggaaa 121 caaatgagaa agctcttgaa gcagtatttg gcaaatatgg acgaatagtg gaagtactct 181 tgatgaaaga ccgtgaaacc aacaaatcaa gaggatttgc ttttgtcacc tttgaaagcc 241 cagcagacgc taaggatgca gccagagaca tgaatggaaa gtcattagat ggaaaagcca 301 tcaaggtgga acaagccacc aaaccatcat ttgaaagtgg tagacgtgga ccgcctccac 361 ctccaagaag tagaggccct ccaagaggtc ttagaggtgg aagaggagga agtggaggaa 421 ccaggggacc tccctcacgg ggaggacaca tggatgacgg tggatattcc atgaatttta 481 acatgagttc ttccagggga ccactcccag taaaaagagg accaccacca agaagtgggg 541 gtcctcctcc taagagatct gcaccttcag gaccagttcg cagtagcagt ggaatgggag 601 gaagagctcc tgtatcacgt ggaagagata gttatggagg tccacctcga agggaaccgc 661 tgccctctcg tagagatgtt tatttgtccc caagagatga tgggtattct actaaagaca 721 gctattcaag cagagattac ccaagttctc gtgatactag agattatgca ccaccaccac 781 gagattatac ttaccgtgat tatggtcatt ccagttcacg tgatgactat ccatcaagag 841 gatatagcga tagagatGGA TATGGTCGTG ATCGTGACTA TTCAGATCAT CCAAGTGGAG 901 GTTCCTACAG AGATTCATAT GAGAGTTATG GTAACTCACG TAGTGCTCCA CCTACACGAG 961 GGCCCCCGCC ATCTTATGGT GGAAGCAGTC GCTATGATGA TTACAGCAGC TCACGTGACG 1021 GATATGGTGG AAGTCGAGAC AGTTACTCAA GCAGCCGAAG TGATCTCTAC TCAAGTGGTC 1081 GTGATCGGGT TGGCAGACAA GAAAGAGGGC TTCCCCCTTC TATGGAAAGG GGGTACCCTC 1141 CTCCACGTGA TTCCTACAGC AGTTCAAGCC GCGGAGCACC AAGAGGTGGT GGCCGTGGAG 1201 GAAGCCGATC TGATAGAGGG GGAGGCAGAA GCAGATACTA CCCAACTTTC TTGTACAAAG 1261 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1321 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1381 ACGATGGATA CTAGCATGCC CCTATGTGAC GCGTTAAGTC gacaatcaac ctctggatta 1441 caaaatttgt gaaagatt