Transcript: Mouse NM_019693.3

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (Ddx39b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ddx39b (53817)
Length:
1756
CDS:
235..1521

Additional Resources:

NCBI RefSeq record:
NM_019693.3
NBCI Gene record:
Ddx39b (53817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074387 TGCCGCAAGTTCATGCAAGAT pLKO.1 949 CDS 100% 4.950 6.930 N DDX39B n/a
2 TRCN0000287043 TGCCGCAAGTTCATGCAAGAT pLKO_005 949 CDS 100% 4.950 6.930 N DDX39B n/a
3 TRCN0000104083 CGCAAGTTCATGCAAGATCCT pLKO.1 952 CDS 100% 2.640 3.696 N Ddx39b n/a
4 TRCN0000335759 CGCAAGTTCATGCAAGATCCT pLKO_005 952 CDS 100% 2.640 3.696 N Ddx39b n/a
5 TRCN0000348734 TCTAGCCCTGGCTCGAAATAA pLKO_005 762 CDS 100% 15.000 10.500 N Ddx39b n/a
6 TRCN0000104081 CCTGAACCTCAAACACATTAA pLKO.1 786 CDS 100% 13.200 9.240 N Ddx39b n/a
7 TRCN0000335758 CCTGAACCTCAAACACATTAA pLKO_005 786 CDS 100% 13.200 9.240 N Ddx39b n/a
8 TRCN0000104082 GCGTGTGAACATTGCTTTCAA pLKO.1 1296 CDS 100% 5.625 3.938 N Ddx39b n/a
9 TRCN0000104080 GCCATCACATTTGTGTCAGAT pLKO.1 1393 CDS 100% 4.950 3.465 N Ddx39b n/a
10 TRCN0000104084 TGTGAACATTGCTTTCAACTA pLKO.1 1299 CDS 100% 4.950 3.465 N Ddx39b n/a
11 TRCN0000335682 TGTGAACATTGCTTTCAACTA pLKO_005 1299 CDS 100% 4.950 3.465 N Ddx39b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07187 pDONR223 100% 92% 99.2% None (many diffs) n/a
2 ccsbBroad304_07187 pLX_304 0% 92% 99.2% V5 (many diffs) n/a
3 TRCN0000471716 TTGTCGAATTCGCCTCTGGCGCAG pLX_317 31.2% 92% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_02356 pDONR223 100% 80.9% 90.1% None (many diffs) n/a
5 ccsbBroad304_02356 pLX_304 0% 80.9% 90.1% V5 (many diffs) n/a
6 TRCN0000470322 TTAATGTTGTCGGCCGCCTCAATT pLX_317 28.9% 80.9% 90.1% V5 (many diffs) n/a
Download CSV