Construct: ORF TRCN0000470322
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015971.1_s317c1
- Derived from:
- ccsbBroadEn_02356
- DNA Barcode:
- TTAATGTTGTCGGCCGCCTCAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDX39A (10212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470322
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10212 | DDX39A | DExD-box helicase 39A | NM_005804.4 | 100% | 100% | |
| 2 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_011527620.1 | 100% | 100% | |
| 3 | human | 7919 | DDX39B | DExD-box helicase 39B | NM_004640.7 | 78.6% | 89.9% | (many diffs) |
| 4 | human | 7919 | DDX39B | DExD-box helicase 39B | NM_080598.6 | 78.6% | 89.9% | (many diffs) |
| 5 | human | 10212 | DDX39A | DExD-box helicase 39A | NR_046366.2 | 75.1% | 1_118del;981_982ins110;1290_1448del | |
| 6 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451310.1 | 59.4% | 53.8% | (many diffs) |
| 7 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_006722606.4 | 51.9% | 51.9% | 0_1ins615 |
| 8 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_011527621.3 | 51.9% | 51.9% | 0_1ins615 |
| 9 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451311.1 | 51.9% | 51.9% | 0_1ins615 |
| 10 | human | 10212 | DDX39A | DExD-box helicase 39A | XM_024451312.1 | 51.9% | 51.9% | 0_1ins615 |
| 11 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | NM_197982.3 | 88.9% | 97.1% | (many diffs) |
| 12 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_006531332.3 | 88.9% | 97.1% | (many diffs) |
| 13 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312949.1 | 82.9% | 90.6% | (many diffs) |
| 14 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312950.1 | 82.9% | 90.6% | (many diffs) |
| 15 | mouse | 53817 | Ddx39b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001252457.1 | 80.9% | 90.1% | (many diffs) |
| 16 | mouse | 53817 | Ddx39b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_019693.3 | 80.9% | 90.1% | (many diffs) |
| 17 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312952.1 | 47.1% | 51.2% | (many diffs) |
| 18 | mouse | 68278 | Ddx39 | DEAD (Asp-Glu-Ala-Asp) box ... | XM_017312951.1 | 44% | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1347
- ORF length:
- 1281
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agaacaggat gtggaaaacg atcttttgga ttacgatgaa gaggaagagc 121 cccaggctcc tcaagagagc acaccagctc cccctaagaa agacatcaag ggatcctacg 181 tttccatcca cagctctggc ttccgggact ttctgctgaa gccggagctc ctgcgggcca 241 tcgtggactg tggctttgag catccttctg aggtccagca tgagtgcatt ccccaggcca 301 tcctgggcat ggacgtcctg tgccaggcca agtccgggat gggcaagaca gcggtcttcg 361 tgctggccac cctacagcag attgagcctg tcaacggaca ggtgacggtc ctggtcatgt 421 gccacacgag ggagctggcc ttccagatca gcaaggaata tgagcgcttt tccaagtaca 481 tgcccagcgt caaggtgtct gtgttcttcg gtggtctctc catcaagaag gatgaagaag 541 tgttgaagaa gaactgtccc catgtcgtgg tggggacccc gggccgcatc ctggcgctcg 601 tgcggaatag gagcttcagc ctaaagaatg tgaagcactt tgtgctggac gagtgtgaca 661 agatgctgga gcagctggac atgcggcggg atgtgcagga gatcttccgc ctgacaccac 721 acgagaagca gtgcatgatg ttcagcgcca ccctgagcaa ggacatccgg cctgtgtgca 781 ggaagttcat gcaggatccc atggaggtgt ttgtggacga cgagaccaag ctcacgctgc 841 acggcctgca gcagtactac gtcaaactca aagacagtga gaagaaccgc aagctctttg 901 atctcttgga tgtgctggag tttaaccagg tgataatctt cgtcaagtca gtgcagcgct 961 gcatggccct ggcccagctc cTCGTGGAGC AGAACTTCCC GGCCATCGCC ATCCACCGGG 1021 GCATGGCCCA GGAGGAGCGC CTGTCACGCT ATCAGCAGTT CAAGGATTTC CAGCGGCGGA 1081 TCCTGGTGGC CACCAATCTG TTTGGCCGGG GGATGGACAT CGAGCGAGTC AACATCGTCT 1141 TTAACTACGA CATGCCTGAG GACTCGGACA CCTACCTGCA CCGGGTGGCC CGGGCGGGTC 1201 GCTTTGGCAC CAAAGGCCTA GCCATCACTT TTGTGTCTGA CGAGAATGAT GCCAAAATCC 1261 TCAATGACGT CCAGGACCGG TTTGAAGTTA ATGTGGCAGA ACTTCCAGAG GAAATCGACA 1321 TCTCCACATA CATCGAGCAG AGCCGGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTAATGTT 1501 GTCGGCCGCC TCAATTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt