Transcript: Mouse NM_019706.3

Mus musculus ring finger protein 138 (Rnf138), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Rnf138 (56515)
Length:
3044
CDS:
345..974

Additional Resources:

NCBI RefSeq record:
NM_019706.3
NBCI Gene record:
Rnf138 (56515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037302 CGTTTATTGGATCACTGTAAT pLKO.1 855 CDS 100% 13.200 10.560 N Rnf138 n/a
2 TRCN0000037300 CTTCTGTCATTCCAAACTTTA pLKO.1 688 CDS 100% 13.200 9.240 N Rnf138 n/a
3 TRCN0000033835 GCATGAGACATCATTACAAAT pLKO.1 634 CDS 100% 13.200 9.240 N RNF138 n/a
4 TRCN0000037303 CCAATATCAAACTGCTGTGGA pLKO.1 929 CDS 100% 2.640 1.848 N Rnf138 n/a
5 TRCN0000037299 CCCTTATGTCAAGAGTCAAAT pLKO.1 822 CDS 100% 13.200 7.920 N Rnf138 n/a
6 TRCN0000037301 CTGCATCTGATAACACAGAAA pLKO.1 754 CDS 100% 4.950 2.970 N Rnf138 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03309 pDONR223 100% 79% 79.1% None (many diffs) n/a
2 ccsbBroad304_03309 pLX_304 0% 79% 79.1% V5 (many diffs) n/a
3 TRCN0000471271 AACGGCGGTGCTAGGCGGGGCCCA pLX_317 53.5% 79% 79.1% V5 (many diffs) n/a
Download CSV