Transcript: Mouse NM_019719.3

Mus musculus STIP1 homology and U-Box containing protein 1 (Stub1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Stub1 (56424)
Length:
1672
CDS:
509..1423

Additional Resources:

NCBI RefSeq record:
NM_019719.3
NBCI Gene record:
Stub1 (56424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008528 CACGATAAATACATGGCAGAT pLKO.1 1121 CDS 100% 4.050 5.670 N Stub1 n/a
2 TRCN0000280520 CACGATAAATACATGGCAGAT pLKO_005 1121 CDS 100% 4.050 5.670 N Stub1 n/a
3 TRCN0000008527 GAGAGTTATGATGAGGCCATT pLKO.1 833 CDS 100% 4.050 5.670 N Stub1 n/a
4 TRCN0000280575 GAGAGTTATGATGAGGCCATT pLKO_005 833 CDS 100% 4.050 5.670 N Stub1 n/a
5 TRCN0000007528 GCAGTCTGTGAAGGCGCACTT pLKO.1 784 CDS 100% 1.350 1.890 N STUB1 n/a
6 TRCN0000352832 GCAGTCTGTGAAGGCGCACTT pLKO_005 784 CDS 100% 1.350 1.890 N STUB1 n/a
7 TRCN0000008526 CCCTGTATAGTTTGTGTCCCT pLKO.1 1482 3UTR 100% 0.660 0.462 N Stub1 n/a
8 TRCN0000008529 GAGAGTGAGCTGCATTCATAT pLKO.1 983 CDS 100% 13.200 7.920 N Stub1 n/a
9 TRCN0000280521 GAGAGTGAGCTGCATTCATAT pLKO_005 983 CDS 100% 13.200 7.920 N Stub1 n/a
10 TRCN0000008530 CCCTTCGCATTGCTAAGAAGA pLKO.1 924 CDS 100% 4.950 2.970 N Stub1 n/a
11 TRCN0000280522 CCCTTCGCATTGCTAAGAAGA pLKO_005 924 CDS 100% 4.950 2.970 N Stub1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02378 pDONR223 100% 88.7% 97.3% None (many diffs) n/a
2 ccsbBroad304_02378 pLX_304 0% 88.7% 97.3% V5 (many diffs) n/a
3 TRCN0000473437 CCGTTTCTACAGCTCATCCCAGGC pLX_317 53.7% 88.7% 97.3% V5 (many diffs) n/a
Download CSV