Transcript: Mouse NM_019771.2

Mus musculus destrin (Dstn), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Dstn (56431)
Length:
1918
CDS:
315..812

Additional Resources:

NCBI RefSeq record:
NM_019771.2
NBCI Gene record:
Dstn (56431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091651 GCTTTGTATGACGCCAGCTTT pLKO.1 561 CDS 100% 4.950 6.930 N Dstn n/a
2 TRCN0000302394 GCTTTGTATGACGCCAGCTTT pLKO_005 561 CDS 100% 4.950 6.930 N Dstn n/a
3 TRCN0000348945 AGCTAGGTGGCTCCTTAATTG pLKO_005 766 CDS 100% 13.200 9.240 N Dstn n/a
4 TRCN0000304745 ACGACATGAAAGTTCGGAAAT pLKO_005 361 CDS 100% 10.800 7.560 N Dstn n/a
5 TRCN0000091652 CCACCATAACTGATCCTTTCA pLKO.1 499 CDS 100% 4.950 3.465 N Dstn n/a
6 TRCN0000302393 CCACCATAACTGATCCTTTCA pLKO_005 499 CDS 100% 4.950 3.465 N Dstn n/a
7 TRCN0000091650 CGCCACCATAACTGATCCTTT pLKO.1 497 CDS 100% 4.950 3.465 N Dstn n/a
8 TRCN0000091649 CCAGGTATAAAGCATGAGTAT pLKO.1 699 CDS 100% 4.950 2.970 N Dstn n/a
9 TRCN0000091648 GCAAATTATTAGGGCTTCATT pLKO.1 1537 3UTR 100% 5.625 2.813 Y Dstn n/a
10 TRCN0000331818 GCAAATTATTAGGGCTTCATT pLKO_005 1537 3UTR 100% 5.625 2.813 Y Dstn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02602 pDONR223 100% 90.7% 95.7% None (many diffs) n/a
2 ccsbBroad304_02602 pLX_304 0% 90.7% 95.7% V5 (many diffs) n/a
3 TRCN0000465993 AGCGACTTCACATGTCTCCTGTTA pLX_317 60% 90.7% 95.7% V5 (many diffs) n/a
Download CSV