Transcript: Mouse NM_019824.4

Mus musculus actin related protein 2/3 complex, subunit 3 (Arpc3), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Arpc3 (56378)
Length:
918
CDS:
115..651

Additional Resources:

NCBI RefSeq record:
NM_019824.4
NBCI Gene record:
Arpc3 (56378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019824.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110780 CCTACCGTATCAAGGAGAGAA pLKO.1 721 3UTR 100% 4.950 6.930 N Arpc3 n/a
2 TRCN0000335007 CCTACCGTATCAAGGAGAGAA pLKO_005 721 3UTR 100% 4.950 6.930 N Arpc3 n/a
3 TRCN0000382309 GATGAAGCCATCTACTACTTC pLKO_005 241 CDS 100% 4.950 6.930 N Arpc3 n/a
4 TRCN0000380317 GCAAACAGGAGGACGAGATGA pLKO_005 479 CDS 100% 4.950 3.960 N Arpc3 n/a
5 TRCN0000348464 TTTGACCCTCAGAGTGATAAA pLKO_005 559 CDS 100% 13.200 9.240 N Arpc3 n/a
6 TRCN0000110781 GCTTTCCTCTCAACGCCATTT pLKO.1 443 CDS 100% 10.800 7.560 N Arpc3 n/a
7 TRCN0000335006 GCTTTCCTCTCAACGCCATTT pLKO_005 443 CDS 100% 10.800 7.560 N Arpc3 n/a
8 TRCN0000380498 GTTCATGAACAAGAGTCTTTC pLKO_005 615 CDS 100% 10.800 7.560 N ARPC3 n/a
9 TRCN0000382497 GACACCAAGCTCATCGGTAAC pLKO_005 148 CDS 100% 6.000 4.200 N Arpc3 n/a
10 TRCN0000110784 CACGCTAGGAATCACCAACTT pLKO.1 402 CDS 100% 4.950 3.465 N Arpc3 n/a
11 TRCN0000110782 GAGACCAAAGACACGGACATT pLKO.1 217 CDS 100% 4.950 3.465 N Arpc3 n/a
12 TRCN0000334939 GAGACCAAAGACACGGACATT pLKO_005 217 CDS 100% 4.950 3.465 N Arpc3 n/a
13 TRCN0000110783 TCAGAGTGATAAACCCAGCAA pLKO.1 567 CDS 100% 2.640 1.848 N Arpc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019824.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02311 pDONR223 100% 86.5% 97.7% None (many diffs) n/a
2 ccsbBroad304_02311 pLX_304 0% 86.5% 97.7% V5 (many diffs) n/a
3 TRCN0000480688 TCGTCTGCCGGACCTCGGCGTGAA pLX_317 69.6% 86.5% 97.7% V5 (many diffs) n/a
Download CSV