Transcript: Mouse NM_019935.3

Mus musculus ovo like zinc finger 1 (Ovol1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ovol1 (18426)
Length:
2900
CDS:
276..1079

Additional Resources:

NCBI RefSeq record:
NM_019935.3
NBCI Gene record:
Ovol1 (18426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418418 GCTTGGGACCATAGGTGTTTG pLKO_005 1271 3UTR 100% 10.800 15.120 N Ovol1 n/a
2 TRCN0000229664 AGTGTCACAACGACGTCAAGA pLKO_005 688 CDS 100% 4.950 6.930 N OVOL1 n/a
3 TRCN0000432936 TCCAGGCACACTTGCACAATT pLKO_005 1193 3UTR 100% 13.200 9.240 N Ovol1 n/a
4 TRCN0000085367 GCCTTCGAGACTCCAGCTATA pLKO.1 466 CDS 100% 10.800 7.560 N Ovol1 n/a
5 TRCN0000085364 GCAGCAGAAGTATGCATACAA pLKO.1 872 CDS 100% 5.625 3.938 N Ovol1 n/a
6 TRCN0000428235 GCGCATGCTGAATCGACACAT pLKO_005 665 CDS 100% 4.950 3.465 N Ovol1 n/a
7 TRCN0000085365 CCTCTGCACTTACTGTGGGAA pLKO.1 713 CDS 100% 2.640 1.848 N Ovol1 n/a
8 TRCN0000085363 CCCACGTTACTGATGTCATAA pLKO.1 2500 3UTR 100% 13.200 7.920 N Ovol1 n/a
9 TRCN0000085366 CTTTCTACGAACCAAGATGAA pLKO.1 572 CDS 100% 4.950 2.970 N Ovol1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01130 pDONR223 100% 90.1% 95.5% None (many diffs) n/a
2 ccsbBroad304_01130 pLX_304 0% 90.1% 95.5% V5 (many diffs) n/a
3 TRCN0000469203 CATCAGGACGTAAAATTGATAAGT pLX_317 57.6% 90.1% 95.5% V5 (many diffs) n/a
Download CSV