Transcript: Mouse NM_019953.1

Mus musculus canopy FGF signaling regulator 2 (Cnpy2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cnpy2 (56530)
Length:
1017
CDS:
343..891

Additional Resources:

NCBI RefSeq record:
NM_019953.1
NBCI Gene record:
Cnpy2 (56530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250880 GAGAGGCTGACAACGTTAAAG pLKO_005 803 CDS 100% 13.200 18.480 N Cnpy2 n/a
2 TRCN0000250878 ACTTACAGGGCATCCGAATTG pLKO_005 698 CDS 100% 10.800 15.120 N Cnpy2 n/a
3 TRCN0000173969 GATGGGATCCTTCCGAATCAA pLKO.1 498 CDS 100% 5.625 7.875 N Cnpy2 n/a
4 TRCN0000138212 CAAGTTTGCGTGTGAGAGCAT pLKO.1 741 CDS 100% 2.640 3.696 N CNPY2 n/a
5 TRCN0000250877 AGGGCTCTGGTGGATGAATTA pLKO_005 436 CDS 100% 13.200 10.560 N Cnpy2 n/a
6 TRCN0000250881 GAATACGAGGATGAGCTTATC pLKO_005 769 CDS 100% 10.800 7.560 N Cnpy2 n/a
7 TRCN0000250879 TGGGATCCTTCCGAATCAATC pLKO_005 500 CDS 100% 10.800 7.560 N Cnpy2 n/a
8 TRCN0000175146 GACAACGTTAAAGACAAACTT pLKO.1 811 CDS 100% 5.625 3.938 N Cnpy2 n/a
9 TRCN0000176006 GAAGAATACGAGGATGAGCTT pLKO.1 766 CDS 100% 2.640 1.848 N Cnpy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02403 pDONR223 100% 91.5% 97.2% None (many diffs) n/a
2 ccsbBroad304_02403 pLX_304 0% 91.5% 97.2% V5 (many diffs) n/a
3 TRCN0000474300 CCTGTTGCCCGGTGAGCCCGTGTA pLX_317 81% 91.5% 97.2% V5 (many diffs) n/a
Download CSV