Transcript: Human NM_020142.3

Homo sapiens NDUFA4 mitochondrial complex associated like 2 (NDUFA4L2), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NDUFA4L2 (56901)
Length:
1275
CDS:
265..528

Additional Resources:

NCBI RefSeq record:
NM_020142.3
NBCI Gene record:
NDUFA4L2 (56901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046590 CATCCCGATGATCGGCTTAAT pLKO.1 324 CDS 100% 13.200 18.480 N NDUFA4L2 n/a
2 TRCN0000046588 GCCTACGTGAGCCAACAAGAA pLKO.1 861 3UTR 100% 4.950 6.930 N NDUFA4L2 n/a
3 TRCN0000046589 CCTTGCAGTTTCCACTGACTA pLKO.1 474 CDS 100% 4.950 3.465 N NDUFA4L2 n/a
4 TRCN0000046592 CTGCTGGGACAGAAAGAACAA pLKO.1 408 CDS 100% 4.950 3.465 N NDUFA4L2 n/a
5 TRCN0000046591 CCACTGACTATAAGAAGCTGA pLKO.1 485 CDS 100% 2.640 1.848 N NDUFA4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03751 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03751 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479559 CAGCCTTTGGTGACTGTGTGCTCA pLX_317 100% 100% 100% V5 n/a
Download CSV