Transcript: Human NM_020179.3

Homo sapiens single-pass membrane protein with coiled-coil domains 4 (SMCO4), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SMCO4 (56935)
Length:
987
CDS:
270..449

Additional Resources:

NCBI RefSeq record:
NM_020179.3
NBCI Gene record:
SMCO4 (56935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168176 CTTGATCGTGGTGTTTGTGTA pLKO.1 398 CDS 100% 4.950 6.930 N SMCO4 n/a
2 TRCN0000141048 CGATAAGTAGCTCCACCTGAA pLKO.1 768 3UTR 100% 4.050 3.240 N SMCO4 n/a
3 TRCN0000297884 CGATAAGTAGCTCCACCTGAA pLKO_005 768 3UTR 100% 4.050 3.240 N SMCO4 n/a
4 TRCN0000167108 CTCTGGTCTTTGACTTGATTA pLKO.1 577 3UTR 100% 13.200 9.240 N SMCO4 n/a
5 TRCN0000280777 CTCTGGTCTTTGACTTGATTA pLKO_005 577 3UTR 100% 13.200 9.240 N SMCO4 n/a
6 TRCN0000168096 CTCACCTCATTCCCATTGTTT pLKO.1 831 3UTR 100% 5.625 3.938 N SMCO4 n/a
7 TRCN0000280779 CTCACCTCATTCCCATTGTTT pLKO_005 831 3UTR 100% 5.625 3.938 N SMCO4 n/a
8 TRCN0000167335 CATTCCCATTGTTTGGATCAT pLKO.1 838 3UTR 100% 4.950 3.465 N SMCO4 n/a
9 TRCN0000168234 CATACACCTTATGGTCCACTT pLKO.1 652 3UTR 100% 4.050 2.835 N SMCO4 n/a
10 TRCN0000122633 GCAGATCACTACAGTGGTGCT pLKO.1 353 CDS 100% 2.160 1.512 N SMCO4 n/a
11 TRCN0000280706 GCAGATCACTACAGTGGTGCT pLKO_005 353 CDS 100% 2.160 1.512 N SMCO4 n/a
12 TRCN0000257892 GAGACCTCCAAGGACAAGAAG pLKO_005 300 CDS 100% 4.950 2.970 N Smco4 n/a
13 TRCN0000122362 CAAGGACAAGAAGGAGCGGAA pLKO.1 308 CDS 100% 2.160 1.296 N SMCO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08668 pDONR223 100% 99.4% 100% None 102G>A n/a
2 ccsbBroad304_08668 pLX_304 0% 99.4% 100% V5 102G>A n/a
3 TRCN0000466275 GACAACTTTTGTCCTCCGTTCTGC pLX_317 100% 99.4% 100% V5 102G>A n/a
Download CSV