Transcript: Human NM_020361.5

Homo sapiens carboxypeptidase A6 (CPA6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CPA6 (57094)
Length:
2011
CDS:
232..1545

Additional Resources:

NCBI RefSeq record:
NM_020361.5
NBCI Gene record:
CPA6 (57094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020361.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371893 ACTACGTGACACTGGATATTT pLKO_005 1425 CDS 100% 15.000 21.000 N CPA6 n/a
2 TRCN0000371894 AGATCCCTCTCTGGATATAAT pLKO_005 616 CDS 100% 15.000 21.000 N CPA6 n/a
3 TRCN0000047006 GTTTGGATAGACTGTGGTATT pLKO.1 796 CDS 100% 10.800 7.560 N CPA6 n/a
4 TRCN0000047003 CCCAGCAGTATCTCCTATGTA pLKO.1 439 CDS 100% 5.625 3.938 N CPA6 n/a
5 TRCN0000047005 GCTCTGGTAGCTCAATGGATT pLKO.1 1364 CDS 100% 4.950 3.465 N CPA6 n/a
6 TRCN0000047007 CAGATGTTACTGTATCCCTAT pLKO.1 1213 CDS 100% 4.050 2.835 N CPA6 n/a
7 TRCN0000047004 CCACCTTTATAACAACCGCTA pLKO.1 321 CDS 100% 2.160 1.512 N CPA6 n/a
8 TRCN0000371892 GGTGATAAAGTGATAAGATTT pLKO_005 346 CDS 100% 13.200 7.920 N CPA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020361.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08696 pDONR223 100% 99.9% 99.7% None 518C>G n/a
2 ccsbBroad304_08696 pLX_304 0% 99.9% 99.7% V5 518C>G n/a
3 TRCN0000480628 TGCGGCATATCCTATAACCGCCCT pLX_317 29.3% 99.9% 99.7% V5 518C>G n/a
Download CSV