Transcript: Human NM_020389.2

Homo sapiens transient receptor potential cation channel subfamily C member 7 (TRPC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TRPC7 (57113)
Length:
2935
CDS:
223..2811

Additional Resources:

NCBI RefSeq record:
NM_020389.2
NBCI Gene record:
TRPC7 (57113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045008 CGGATCAAACTCGCCATTAAA pLKO.1 1150 CDS 100% 15.000 21.000 N TRPC7 n/a
2 TRCN0000045011 CGCCTACATGTTCAACGAGAA pLKO.1 309 CDS 100% 4.050 5.670 N TRPC7 n/a
3 TRCN0000045009 GCCAAATACAACCCAGCGTTT pLKO.1 2041 CDS 100% 4.050 5.670 N TRPC7 n/a
4 TRCN0000068459 GCCAACATTGAGACTGAATTT pLKO.1 979 CDS 100% 13.200 9.240 N Trpc7 n/a
5 TRCN0000068462 CTTACTTTGATGAAGGAAGAA pLKO.1 2312 CDS 100% 4.950 3.465 N Trpc7 n/a
6 TRCN0000045010 CGACCACAAATTCATCGAGAA pLKO.1 2142 CDS 100% 4.050 2.835 N TRPC7 n/a
7 TRCN0000045012 GCTCATTATGAAGTGGGTCTT pLKO.1 1545 CDS 100% 4.050 2.835 N TRPC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08701 pDONR223 100% 99.9% 100% None 501C>T n/a
2 ccsbBroad304_08701 pLX_304 0% 99.9% 100% V5 501C>T n/a
3 TRCN0000474370 AGTTTATTACCGTTTACCAAGGCC pLX_317 18.3% 99.9% 100% V5 501C>T n/a
Download CSV