Transcript: Human NM_020412.5

Homo sapiens charged multivesicular body protein 1B (CHMP1B), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CHMP1B (57132)
Length:
3032
CDS:
100..699

Additional Resources:

NCBI RefSeq record:
NM_020412.5
NBCI Gene record:
CHMP1B (57132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020412.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165547 GTCGATGGATGCGACATTGAA pLKO.1 390 CDS 100% 5.625 7.875 N CHMP1B n/a
2 TRCN0000166094 GAACTGAGTAGGAGTGCCAAA pLKO.1 148 CDS 100% 4.050 3.240 N CHMP1B n/a
3 TRCN0000100774 CAACATGGAAGTTGCGAGGAT pLKO.1 228 CDS 100% 2.640 2.112 N Chmp1b n/a
4 TRCN0000166391 CAACATGGAAGTTGCGAGGAT pLKO.1 228 CDS 100% 2.640 2.112 N CHMP1B n/a
5 TRCN0000161212 GCACTCTTAGCTGGATTCTAA pLKO.1 870 3UTR 100% 5.625 3.938 N CHMP1B n/a
6 TRCN0000161474 GCGACATTGAAGACCATGAAT pLKO.1 400 CDS 100% 5.625 3.938 N CHMP1B n/a
7 TRCN0000164819 CAGAAGGGCAACATGGAAGTT pLKO.1 220 CDS 100% 4.950 3.465 N CHMP1B n/a
8 TRCN0000160950 GACAAATTCGAGCACCAGTTT pLKO.1 445 CDS 100% 4.950 3.465 N CHMP1B n/a
9 TRCN0000278459 GACAAATTCGAGCACCAGTTT pLKO_005 445 CDS 100% 4.950 3.465 N CHMP1B n/a
10 TRCN0000381274 GCCATTCAGAAGGGCAACATG pLKO_005 214 CDS 100% 4.950 3.465 N Chmp1b n/a
11 TRCN0000159294 GCTGGATTCTAAAGTTCTGTA pLKO.1 879 3UTR 100% 4.950 3.465 N CHMP1B n/a
12 TRCN0000297190 GCTGGATTCTAAAGTTCTGTA pLKO_005 879 3UTR 100% 4.950 3.465 N CHMP1B n/a
13 TRCN0000158735 GATTTCTGCTTTGATGGACAA pLKO.1 429 CDS 100% 4.050 2.835 N CHMP1B n/a
14 TRCN0000297467 GATTTCTGCTTTGATGGACAA pLKO_005 429 CDS 100% 4.050 2.835 N CHMP1B n/a
15 TRCN0000380120 GGACGTCCAGACGCAGCAAAT pLKO_005 474 CDS 100% 3.600 2.520 N Chmp1b n/a
16 TRCN0000166491 CCAGAACCAAGTGGATATGCT pLKO.1 534 CDS 100% 3.000 2.100 N CHMP1B n/a
17 TRCN0000278418 CCAGAACCAAGTGGATATGCT pLKO_005 534 CDS 100% 3.000 2.100 N CHMP1B n/a
18 TRCN0000160848 GACCATGAATCTGGAGAAGAT pLKO.1 411 CDS 100% 4.950 2.970 N CHMP1B n/a
19 TRCN0000278458 GACCATGAATCTGGAGAAGAT pLKO_005 411 CDS 100% 4.950 2.970 N CHMP1B n/a
20 TRCN0000380264 ACATGGAAGTTGCGAGGATTC pLKO_005 230 CDS 100% 6.000 4.800 N Chmp1b n/a
21 TRCN0000100773 CGCAGCAAATGGAAGACACAA pLKO.1 485 CDS 100% 4.950 3.465 N Chmp1b n/a
22 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2670 3UTR 100% 5.625 2.813 Y KLHL30 n/a
23 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2670 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020412.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03790 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03790 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470343 AGGAACAGCCGACTATTCGATCCG pLX_317 71.6% 100% 100% V5 n/a
Download CSV