Transcript: Mouse NM_020587.2

Mus musculus serine/arginine-rich splicing factor 4 (Srsf4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Srsf4 (57317)
Length:
2254
CDS:
126..1601

Additional Resources:

NCBI RefSeq record:
NM_020587.2
NBCI Gene record:
Srsf4 (57317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071587 GTGTCAAAGGAGCGCGAACAT pLKO.1 1347 CDS 100% 4.950 6.930 N Srsf4 n/a
2 TRCN0000327131 GTGTCAAAGGAGCGCGAACAT pLKO_005 1347 CDS 100% 4.950 6.930 N Srsf4 n/a
3 TRCN0000071583 CCGCAGTAAGAGTAAAGACCA pLKO.1 923 CDS 100% 2.640 2.112 N Srsf4 n/a
4 TRCN0000327059 CCGCAGTAAGAGTAAAGACCA pLKO_005 923 CDS 100% 2.640 2.112 N Srsf4 n/a
5 TRCN0000071584 GAACTGAAGTCAACGGCAGAA pLKO.1 610 CDS 100% 4.050 2.835 N Srsf4 n/a
6 TRCN0000327061 GAACTGAAGTCAACGGCAGAA pLKO_005 610 CDS 100% 4.050 2.835 N Srsf4 n/a
7 TRCN0000071586 CAGGTCAAGATCCACCTCCAA pLKO.1 1442 CDS 100% 2.640 1.848 N Srsf4 n/a
8 TRCN0000327060 CAGGTCAAGATCCACCTCCAA pLKO_005 1442 CDS 100% 2.640 1.848 N Srsf4 n/a
9 TRCN0000071585 CCCTGACAAGAGCCGCAGTAA pLKO.1 911 CDS 100% 1.650 1.155 N Srsf4 n/a
10 TRCN0000327058 CCCTGACAAGAGCCGCAGTAA pLKO_005 911 CDS 100% 1.650 1.155 N Srsf4 n/a
11 TRCN0000231449 GACGCAGTGGATATGGTTATA pLKO_005 370 CDS 100% 13.200 9.240 N SRSF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01523 pDONR223 100% 84.2% 87.6% None (many diffs) n/a
2 ccsbBroad304_01523 pLX_304 0% 84.2% 87.6% V5 (many diffs) n/a
3 TRCN0000481291 ACGCTTAGAATAAATTACATATGA pLX_317 31.7% 84.2% 87.6% V5 (many diffs) n/a
Download CSV