Transcript: Mouse NM_020626.2

Mus musculus transmembrane protein 27 (Tmem27), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem27 (57394)
Length:
1262
CDS:
87..755

Additional Resources:

NCBI RefSeq record:
NM_020626.2
NBCI Gene record:
Tmem27 (57394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087394 CCTTCCAACAATTATACTCTT pLKO.1 354 CDS 100% 4.950 6.930 N Tmem27 n/a
2 TRCN0000087393 CCAATGAAATCATAAGGTGTT pLKO.1 825 3UTR 100% 4.050 5.670 N Tmem27 n/a
3 TRCN0000087396 AGTCGGCCATAAGAAAGAATA pLKO.1 391 CDS 100% 13.200 9.240 N Tmem27 n/a
4 TRCN0000087395 GCCCGTCTGGATTATTGTATT pLKO.1 506 CDS 100% 13.200 9.240 N Tmem27 n/a
5 TRCN0000087397 GCACATTAATGATGGCTTCTT pLKO.1 704 CDS 100% 4.950 3.465 N Tmem27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14230 pDONR223 100% 86% 84.2% None (many diffs) n/a
2 ccsbBroad304_14230 pLX_304 0% 86% 84.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472446 AGAGCAACGATACTTGAGCCGTAC pLX_317 75.3% 86% 84.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV