Transcript: Human NM_020716.3

Homo sapiens GRAM domain containing 1B (GRAMD1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
GRAMD1B (57476)
Length:
7934
CDS:
524..2740

Additional Resources:

NCBI RefSeq record:
NM_020716.3
NBCI Gene record:
GRAMD1B (57476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257476 GAGGACTACTTCCGCCATTTA pLKO_005 2096 CDS 100% 13.200 18.480 N GRAMD1B n/a
2 TRCN0000257493 CATGTACATAGACCATATAAA pLKO_005 2781 3UTR 100% 15.000 10.500 N GRAMD1B n/a
3 TRCN0000247556 ACTACTTCTACACAATCAATC pLKO_005 1950 CDS 100% 10.800 7.560 N GRAMD1B n/a
4 TRCN0000257486 AGAGTGAATGTTACGTGATAG pLKO_005 1893 CDS 100% 10.800 7.560 N GRAMD1B n/a
5 TRCN0000257481 TCCCAATGCCATCCAAGTTTG pLKO_005 1027 CDS 100% 10.800 7.560 N GRAMD1B n/a
6 TRCN0000136423 CTGCTTCTACAGCAACATCTT pLKO.1 931 CDS 100% 4.950 2.475 Y GRAMD1A n/a
7 TRCN0000200720 GCCTCATTGTTGATTACTCTT pLKO.1 852 CDS 100% 4.950 2.970 N Gramd1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08735 pDONR223 100% 99.9% 100% None 1425T>C n/a
2 ccsbBroad304_08735 pLX_304 0% 99.9% 100% V5 1425T>C n/a
3 TRCN0000465695 GACTAAAGGTCGTCCTACCGATTA pLX_317 16.2% 99.9% 100% V5 1425T>C n/a
4 ccsbBroadEn_08736 pDONR223 100% 99.9% 100% None 930G>A;1425T>C n/a
5 ccsbBroad304_08736 pLX_304 0% 99.9% 100% V5 930G>A;1425T>C n/a
6 TRCN0000481176 CCCAACGGCCCCACGATTGATAAG pLX_317 18.1% 99.9% 100% V5 930G>A;1425T>C n/a
Download CSV