Transcript: Human NM_020815.3

Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PCDH10 (57575)
Length:
4595
CDS:
848..3538

Additional Resources:

NCBI RefSeq record:
NM_020815.3
NBCI Gene record:
PCDH10 (57575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378320 TAAGCGGCGAGTTGGACTATG pLKO_005 1782 CDS 100% 10.800 15.120 N PCDH10 n/a
2 TRCN0000358731 TTCGTGTGTAACCTAACTTTC pLKO_005 3639 3UTR 100% 10.800 15.120 N PCDH10 n/a
3 TRCN0000053556 CGTTTCTATCAACTCTGAGAA pLKO.1 2392 CDS 100% 4.950 3.960 N PCDH10 n/a
4 TRCN0000378249 ATCGAGGTGCTGGACATTAAT pLKO_005 1175 CDS 100% 15.000 10.500 N PCDH10 n/a
5 TRCN0000358720 CATCGTGCGTGGCAACGAAAT pLKO_005 2704 CDS 100% 10.800 7.560 N PCDH10 n/a
6 TRCN0000053554 GCCACTGTCAACATCCTCATA pLKO.1 2519 CDS 100% 4.950 3.465 N PCDH10 n/a
7 TRCN0000053557 GCAGCCTGATATCATCTCCAA pLKO.1 3436 CDS 100% 2.640 1.848 N PCDH10 n/a
8 TRCN0000053553 CCGCCTCAAGTCTTCCTTTAA pLKO.1 2056 CDS 100% 13.200 7.920 N PCDH10 n/a
9 TRCN0000053555 GCGCAAGAAGAAACTCAGCAA pLKO.1 3178 CDS 100% 2.640 1.584 N PCDH10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08745 pDONR223 100% 85.3% 84.6% None (many diffs) n/a
2 ccsbBroad304_08745 pLX_304 0% 85.3% 84.6% V5 (many diffs) n/a
3 TRCN0000478590 GCCGAACCTAACTACTTGTCAGTT pLX_317 10.4% 85.3% 84.6% V5 (many diffs) n/a
Download CSV