Transcript: Human NM_020860.4

Homo sapiens stromal interaction molecule 2 (STIM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
STIM2 (57620)
Length:
5004
CDS:
379..2619

Additional Resources:

NCBI RefSeq record:
NM_020860.4
NBCI Gene record:
STIM2 (57620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150632 GCACGAACCTTCATTTATGAT pLKO.1 897 CDS 100% 5.625 7.875 N STIM2 n/a
2 TRCN0000429762 GTGGCTTTCAGATAGCCCATA pLKO_005 1700 CDS 100% 4.050 5.670 N STIM2 n/a
3 TRCN0000151484 CGCTGTAAAGATCATGTTGTT pLKO.1 3297 3UTR 100% 4.950 3.960 N STIM2 n/a
4 TRCN0000154373 CCCTGCGCTTTATCGAAATGA pLKO.1 2079 CDS 100% 5.625 3.938 N STIM2 n/a
5 TRCN0000429172 GACACTCTTCAGTGGTTGATA pLKO_005 796 CDS 100% 5.625 3.938 N STIM2 n/a
6 TRCN0000150553 GCTATTTACATCCTGGACTAT pLKO.1 3024 3UTR 100% 4.950 3.465 N STIM2 n/a
7 TRCN0000150821 GCTCAATTTCAGACACTCATT pLKO.1 4727 3UTR 100% 4.950 3.465 N STIM2 n/a
8 TRCN0000187941 GCTTCAGAATGTGACTCCTTA pLKO.1 2158 CDS 100% 4.950 3.465 N Stim2 n/a
9 TRCN0000151011 GAAGTTCATAATTGGACCCTT pLKO.1 772 CDS 100% 2.640 1.848 N STIM2 n/a
10 TRCN0000152340 CCACATGACCTTTGTCATAAT pLKO.1 2539 CDS 100% 1.320 0.924 N STIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08749 pDONR223 100% 70.6% 70.8% None (many diffs) n/a
2 ccsbBroad304_08749 pLX_304 0% 70.6% 70.8% V5 (many diffs) n/a
3 TRCN0000477969 CAAAGACCCGGTAGCAACATAGAT pLX_317 20.4% 70.6% 70.8% V5 (many diffs) n/a
Download CSV