Transcript: Human NM_020882.3

Homo sapiens collagen type XX alpha 1 chain (COL20A1), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
COL20A1 (57642)
Length:
8090
CDS:
101..3955

Additional Resources:

NCBI RefSeq record:
NM_020882.3
NBCI Gene record:
COL20A1 (57642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116862 CCCTCAAGTATCTGATCGTTT pLKO.1 1311 CDS 100% 4.950 6.930 N COL20A1 n/a
2 TRCN0000116863 CGTGTCAAAGTTCGACTCCTT pLKO.1 3718 CDS 100% 2.640 3.696 N COL20A1 n/a
3 TRCN0000116864 CCCGACCTTCACGCTCTTCAA pLKO.1 2716 CDS 100% 1.650 1.320 N COL20A1 n/a
4 TRCN0000116865 CCGCAGGAAGTGAGGAAGATT pLKO.1 2975 CDS 100% 5.625 3.938 N COL20A1 n/a
5 TRCN0000116866 GCTCCATTACTGGCTCACCTA pLKO.1 2404 CDS 100% 2.640 1.848 N COL20A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12382 pDONR223 100% 49.4% 47.2% None (many diffs) n/a
2 ccsbBroad304_12382 pLX_304 0% 49.4% 47.2% V5 (many diffs) n/a
3 TRCN0000465395 CCCGTTATTTACTGAGACAACGAC pLX_317 11.6% 49.4% 47.2% V5 (many diffs) n/a
4 ccsbBroadEn_12381 pDONR223 100% 11.5% 11.4% None 1_3405del;3613_3614insGTGAGTCTGCCATTCAGA n/a
5 ccsbBroad304_12381 pLX_304 0% 11.5% 11.4% V5 1_3405del;3613_3614insGTGAGTCTGCCATTCAGA n/a
6 TRCN0000466498 CCGACGGTGTTTCAAGTGTTGATG pLX_317 73.6% 11.5% 11.4% V5 1_3405del;3613_3614insGTGAGTCTGCCATTCAGA n/a
Download CSV