Transcript: Human NM_021067.5

Homo sapiens GINS complex subunit 1 (GINS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
GINS1 (9837)
Length:
3311
CDS:
149..739

Additional Resources:

NCBI RefSeq record:
NM_021067.5
NBCI Gene record:
GINS1 (9837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021067.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128651 CTTGCCAAATGCATTACGATT pLKO.1 439 CDS 100% 4.950 6.930 N GINS1 n/a
2 TRCN0000128417 GACACTGTTCTCTGTTAAGAA pLKO.1 342 CDS 100% 5.625 3.938 N GINS1 n/a
3 TRCN0000278904 GACACTGTTCTCTGTTAAGAA pLKO_005 342 CDS 100% 5.625 3.938 N GINS1 n/a
4 TRCN0000129957 GAGGAGATGAAAGCTTTGTAT pLKO.1 248 CDS 100% 5.625 3.938 N GINS1 n/a
5 TRCN0000130071 GAGAGCTGAATTTCTGAGATA pLKO.1 1268 3UTR 100% 4.950 3.465 N GINS1 n/a
6 TRCN0000129457 GAGGATGGACTCAGACAAGTT pLKO.1 224 CDS 100% 4.950 3.465 N GINS1 n/a
7 TRCN0000127692 GATCACCAGTATCACCACTTT pLKO.1 1457 3UTR 100% 4.950 3.465 N GINS1 n/a
8 TRCN0000278908 GATCACCAGTATCACCACTTT pLKO_005 1457 3UTR 100% 4.950 3.465 N GINS1 n/a
9 TRCN0000129421 CAGACAAGTTCTGGAGGAGAT pLKO.1 235 CDS 100% 4.050 2.835 N GINS1 n/a
10 TRCN0000278909 CAGACAAGTTCTGGAGGAGAT pLKO_005 235 CDS 100% 4.050 2.835 N GINS1 n/a
11 TRCN0000128416 GCTGAATTTCTGAGATACACA pLKO.1 1272 3UTR 100% 3.000 2.100 N GINS1 n/a
12 TRCN0000278907 GCTGAATTTCTGAGATACACA pLKO_005 1272 3UTR 100% 3.000 2.100 N GINS1 n/a
13 TRCN0000127531 CAAGTTCTGGAGGAGATGAAA pLKO.1 239 CDS 100% 5.625 3.375 N GINS1 n/a
14 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 2605 3UTR 100% 13.200 6.600 Y C9orf139 n/a
15 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 2655 3UTR 100% 4.050 2.025 Y ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021067.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07495 pDONR223 100% 99.8% 99.4% None 289G>A n/a
2 ccsbBroad304_07495 pLX_304 0% 99.8% 99.4% V5 289G>A n/a
3 TRCN0000476112 AGCCATAGGTCTTTCACCCCAACT pLX_317 62.8% 99.8% 99.4% V5 289G>A n/a
Download CSV