Transcript: Human NM_021134.4

Homo sapiens mitochondrial ribosomal protein L23 (MRPL23), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MRPL23 (6150)
Length:
673
CDS:
32..493

Additional Resources:

NCBI RefSeq record:
NM_021134.4
NBCI Gene record:
MRPL23 (6150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021134.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117699 AGCATGGCTCTAACAAGAGAA pLKO.1 249 CDS 100% 4.950 2.475 Y MRPL23 n/a
2 TRCN0000300705 AGCATGGCTCTAACAAGAGAA pLKO_005 249 CDS 100% 4.950 2.475 Y MRPL23 n/a
3 TRCN0000117700 CAGAAACGTGAGGATCAAGAA pLKO.1 277 CDS 100% 4.950 2.475 Y MRPL23 n/a
4 TRCN0000300645 CAGAAACGTGAGGATCAAGAA pLKO_005 277 CDS 100% 4.950 2.475 Y MRPL23 n/a
5 TRCN0000117697 CCAGATCTGTTTCCCGAGAAA pLKO.1 353 CDS 100% 4.950 2.475 Y MRPL23 n/a
6 TRCN0000310652 CCAGATCTGTTTCCCGAGAAA pLKO_005 353 CDS 100% 4.950 2.475 Y MRPL23 n/a
7 TRCN0000117698 GTTCCGAACCAACTTCTTCAT pLKO.1 88 CDS 100% 4.950 2.475 Y MRPL23 n/a
8 TRCN0000300646 GTTCCGAACCAACTTCTTCAT pLKO_005 88 CDS 100% 4.950 2.475 Y MRPL23 n/a
9 TRCN0000117701 CATGGAAATGACAAGGGTGGA pLKO.1 166 CDS 100% 2.160 1.080 Y MRPL23 n/a
10 TRCN0000300644 CATGGAAATGACAAGGGTGGA pLKO_005 166 CDS 100% 2.160 1.080 Y MRPL23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021134.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01426 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01426 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466267 GAATAATCCGTTCCGCGCGCTTAT pLX_317 63.8% 100% 100% V5 n/a
Download CSV