Transcript: Human NM_021151.4

Homo sapiens carnitine O-octanoyltransferase (CROT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CROT (54677)
Length:
3205
CDS:
217..2055

Additional Resources:

NCBI RefSeq record:
NM_021151.4
NBCI Gene record:
CROT (54677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147191 TGGTATACGAACATCCAGAT pXPR_003 AGG 271 15% 5 0.8878 CROT CROT 77706
2 BRDN0001147219 GGAGATCCAACAGTACGCTG pXPR_003 GGG 914 50% 10 0.6052 ABCB4, CROT CROT 77707
3 BRDN0001144889 CTCGACACAGCACTACAATG pXPR_003 TGG 575 31% 7 0.6042 CROT CROT 77708
4 BRDN0001145682 GATTGCAGCATTAACTAGTG pXPR_003 AGG 724 39% 8 -0.1857 ABCB4, CROT CROT 77709
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229364 CTTCACCCGGATACGTTTATT pLKO_005 1456 CDS 100% 15.000 21.000 N CROT n/a
2 TRCN0000036013 GCCTATCTGGATGTTCGTATA pLKO.1 481 CDS 100% 10.800 15.120 N CROT n/a
3 TRCN0000036012 CCGGATACGTTTATTCAGCTT pLKO.1 1462 CDS 100% 2.640 3.696 N CROT n/a
4 TRCN0000229362 AGAGTAGTTTACTGGTATATT pLKO_005 1025 CDS 100% 15.000 12.000 N CROT n/a
5 TRCN0000229363 ATGTAACACCAGAGGATTATT pLKO_005 1067 CDS 100% 15.000 10.500 N CROT n/a
6 TRCN0000218986 TGAACTACTGGCAGCTATTAA pLKO_005 614 CDS 100% 15.000 10.500 N CROT n/a
7 TRCN0000229365 TGGTACTTACATGGGTTATAA pLKO_005 2384 3UTR 100% 15.000 10.500 N CROT n/a
8 TRCN0000036011 GCCTGTTCATAAAGTTGGAAA pLKO.1 648 CDS 100% 4.950 3.465 N CROT n/a
9 TRCN0000036009 CGAGAATATCTGATTGGTCTT pLKO.1 970 CDS 100% 4.050 2.835 N CROT n/a
10 TRCN0000036010 CCATCCTTATTGGAGATCCAA pLKO.1 1103 CDS 100% 3.000 2.100 N CROT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10240 pDONR223 100% 13.9% 13.1% None (many diffs) n/a
2 ccsbBroad304_10240 pLX_304 0% 13.9% 13.1% V5 (many diffs) n/a
3 TRCN0000466600 GACAATGAGAGATCCGTACAATTC pLX_317 100% 13.9% 13.1% V5 (many diffs) n/a
Download CSV