Transcript: Human NM_021199.4

Homo sapiens sulfide quinone oxidoreductase (SQOR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SQOR (58472)
Length:
1701
CDS:
98..1450

Additional Resources:

NCBI RefSeq record:
NM_021199.4
NBCI Gene record:
SQOR (58472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039004 GCGCCTTTCCATGTATCTCAT pLKO.1 1327 CDS 100% 4.950 6.930 N SQOR n/a
2 TRCN0000042376 GCTGGACTATGAGAAGATTAA pLKO.1 541 CDS 100% 13.200 9.240 N Sqor n/a
3 TRCN0000334467 GCTGGACTATGAGAAGATTAA pLKO_005 541 CDS 100% 13.200 9.240 N Sqor n/a
4 TRCN0000039008 CCGTGTGATTCTTGCTGAGTT pLKO.1 1255 CDS 100% 4.950 3.465 N SQOR n/a
5 TRCN0000039006 CCTCACTGTTAACTACAAGAA pLKO.1 859 CDS 100% 4.950 3.465 N SQOR n/a
6 TRCN0000039005 GCTTCATGTCACACCTCCAAT pLKO.1 970 CDS 100% 4.950 3.465 N SQOR n/a
7 TRCN0000039007 GAGACATTTCTACCAGCCAAT pLKO.1 331 CDS 100% 4.050 2.835 N SQOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08775 pDONR223 100% 99.8% 100% None 12G>T;1341A>T n/a
2 ccsbBroad304_08775 pLX_304 0% 99.8% 100% V5 12G>T;1341A>T n/a
3 TRCN0000478176 TGATTCCTATGGTCTCCAGTCTAC pLX_317 18.6% 99.8% 100% V5 12G>T;1341A>T n/a
Download CSV