Transcript: Human NM_021260.4

Homo sapiens zinc finger FYVE-type containing 1 (ZFYVE1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZFYVE1 (53349)
Length:
4380
CDS:
616..2949

Additional Resources:

NCBI RefSeq record:
NM_021260.4
NBCI Gene record:
ZFYVE1 (53349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156386 CCAGTATGACAACCGAGTGTA pLKO.1 2004 CDS 100% 4.950 6.930 N ZFYVE1 n/a
2 TRCN0000158126 CCTCGTCATCTATCGAACTCA pLKO.1 1398 CDS 100% 3.000 4.200 N ZFYVE1 n/a
3 TRCN0000156007 CGAGTCCTTCACAATTCCTTA pLKO.1 2965 3UTR 100% 4.950 3.960 N ZFYVE1 n/a
4 TRCN0000157951 CGGGACTGATGAAGCTATCTT pLKO.1 690 CDS 100% 5.625 3.938 N ZFYVE1 n/a
5 TRCN0000154801 GCACAGGATGAACTGTTAGTT pLKO.1 3950 3UTR 100% 5.625 3.938 N ZFYVE1 n/a
6 TRCN0000151699 CATCTGAAAGTGGTTTCCATT pLKO.1 1150 CDS 100% 4.950 3.465 N ZFYVE1 n/a
7 TRCN0000158280 CCAGATTCTGAGCTGCAACAA pLKO.1 2412 CDS 100% 4.950 3.465 N ZFYVE1 n/a
8 TRCN0000157892 CCCGTTGTGCTGAAATCCTAT pLKO.1 4109 3UTR 100% 4.950 3.465 N ZFYVE1 n/a
9 TRCN0000156723 GACATACCACTAGGTCTGGTA pLKO.1 2704 CDS 100% 0.264 0.185 N ZFYVE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03388 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03388 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474008 TAATCGAAAAGCGATACAGCGACG pLX_317 16.1% 100% 100% V5 n/a
Download CSV