Transcript: Mouse NM_021291.3

Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 (Slc7a9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc7a9 (30962)
Length:
1929
CDS:
327..1790

Additional Resources:

NCBI RefSeq record:
NM_021291.3
NBCI Gene record:
Slc7a9 (30962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313370 GTTGGAACCAACTCAACTATA pLKO_005 1027 CDS 100% 13.200 18.480 N Slc7a9 n/a
2 TRCN0000079442 GCTTGGCACAATGATTACCAA pLKO.1 581 CDS 100% 3.000 4.200 N Slc7a9 n/a
3 TRCN0000312342 GCTTGGCACAATGATTACCAA pLKO_005 581 CDS 100% 3.000 4.200 N Slc7a9 n/a
4 TRCN0000079440 CCTATCATTGTGATTCTCGTA pLKO.1 1566 CDS 100% 2.640 3.696 N Slc7a9 n/a
5 TRCN0000079438 GCTCTCCTACATCAGTGTCAA pLKO.1 1346 CDS 100% 4.950 3.960 N Slc7a9 n/a
6 TRCN0000312343 GCTCTCCTACATCAGTGTCAA pLKO_005 1346 CDS 100% 4.950 3.960 N Slc7a9 n/a
7 TRCN0000313372 ATCAACTCCTTAGTCAATTAT pLKO_005 1437 CDS 100% 15.000 10.500 N Slc7a9 n/a
8 TRCN0000313306 TCATACTGAGTGGACTTATAT pLKO_005 1654 CDS 100% 15.000 10.500 N Slc7a9 n/a
9 TRCN0000079441 GTATGCTACATCCTCATGAAT pLKO.1 1119 CDS 100% 5.625 3.938 N Slc7a9 n/a
10 TRCN0000079439 CCAAGGAAATGTAAAGAACTT pLKO.1 926 CDS 100% 4.950 3.465 N Slc7a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02625 pDONR223 100% 83.5% 86.8% None (many diffs) n/a
2 ccsbBroad304_02625 pLX_304 0% 83.5% 86.8% V5 (many diffs) n/a
3 TRCN0000480861 AGTCCTACGGTTGTGAATCTGCTC pLX_317 33.2% 83.5% 86.8% V5 (many diffs) n/a
Download CSV