Transcript: Mouse NM_021296.2

Mus musculus GrpE-like 2, mitochondrial (Grpel2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Grpel2 (17714)
Length:
4065
CDS:
33..707

Additional Resources:

NCBI RefSeq record:
NM_021296.2
NBCI Gene record:
Grpel2 (17714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234888 ACTTCATGGCCGCACCATTAG pLKO_005 641 CDS 100% 10.800 15.120 N GRPEL2 n/a
2 TRCN0000337952 ACTTCATGGCCGCACCATTAG pLKO_005 641 CDS 100% 10.800 15.120 N Grpel2 n/a
3 TRCN0000337986 GACACGTGTCGTGGCCTTTAT pLKO_005 912 3UTR 100% 13.200 10.560 N Grpel2 n/a
4 TRCN0000337917 GTGGAAGACGCGAAGATATTT pLKO_005 321 CDS 100% 15.000 10.500 N Grpel2 n/a
5 TRCN0000337915 TTAAGGCTCAAAGCTGTTAAA pLKO_005 213 CDS 100% 13.200 9.240 N Grpel2 n/a
6 TRCN0000337984 ACCAGAGAGCTGTCGCTGATT pLKO_005 268 CDS 100% 4.950 3.465 N Grpel2 n/a
7 TRCN0000183877 CTGCTAGAAGCCAGACTGAAA pLKO.1 474 CDS 100% 4.950 3.465 N Grpel2 n/a
8 TRCN0000180624 GCCGTGACAATACAACTCAAT pLKO.1 1329 3UTR 100% 4.950 3.465 N Grpel2 n/a
9 TRCN0000180348 GCGTGTAGAGAGATTTCCTAA pLKO.1 1139 3UTR 100% 4.950 3.465 N Grpel2 n/a
10 TRCN0000180846 GCTGACATTGACATCACACTT pLKO.1 2038 3UTR 100% 4.950 2.970 N Grpel2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04890 pDONR223 100% 85% 84.8% None (many diffs) n/a
2 ccsbBroad304_04890 pLX_304 0% 85% 84.8% V5 (many diffs) n/a
3 TRCN0000491526 GTTCTTTAGACCGAAATTCTCTTC pLX_317 43.5% 85% 84.8% V5 (many diffs) n/a
Download CSV