Transcript: Mouse NM_021442.2

Mus musculus MDS1 and EVI1 complex locus (Mecom), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mecom (14013)
Length:
1075
CDS:
22..411

Additional Resources:

NCBI RefSeq record:
NM_021442.2
NBCI Gene record:
Mecom (14013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085077 AGGAAGATTGAAATAGGCGAA pLKO.1 319 CDS 100% 2.160 3.024 N Mecom n/a
2 TRCN0000085073 GCCAGTACAGTATGTAAATAT pLKO.1 451 3UTR 100% 15.000 12.000 N Mecom n/a
3 TRCN0000085076 GCCATACAAAGCTCCCATCTA pLKO.1 213 CDS 100% 4.950 3.960 N Mecom n/a
4 TRCN0000085075 CCTATGGCAACTATCCTGAAA pLKO.1 71 CDS 100% 4.950 3.465 N Mecom n/a
5 TRCN0000085074 CCAGTGAGTCATTTACTCCTA pLKO.1 182 CDS 100% 2.640 1.848 N Mecom n/a
6 TRCN0000015587 CCTTTGGAAGAAATGCCAGAT pLKO.1 94 CDS 100% 4.050 2.430 N MECOM n/a
7 TRCN0000015585 CCCATCTACATCCCTGATGAT pLKO.1 226 CDS 100% 4.950 3.465 N MECOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10811 pDONR223 100% 66.2% 65.4% None (many diffs) n/a
2 ccsbBroad304_10811 pLX_304 0% 66.2% 65.4% V5 (many diffs) n/a
3 TRCN0000474954 TCGCGCCCGGTTCGACTACGGGTG pLX_317 70.5% 66.2% 65.4% V5 (many diffs) n/a
Download CSV