Transcript: Mouse NM_021486.3

Mus musculus beta-carotene oxygenase 1 (Bco1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Mus musculus (mouse)
Gene:
Bco1 (63857)
Length:
2327
CDS:
167..1867

Additional Resources:

NCBI RefSeq record:
NM_021486.3
NBCI Gene record:
Bco1 (63857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076325 CCAACCAAGATACTGAAATAT pLKO.1 1460 CDS 100% 15.000 12.000 N Bco1 n/a
2 TRCN0000076324 CCCTCGGATAAATTATGCTTA pLKO.1 1384 CDS 100% 4.950 3.465 N Bco1 n/a
3 TRCN0000076326 GAGACCAACTACATCAGGAAA pLKO.1 584 CDS 100% 4.950 3.465 N Bco1 n/a
4 TRCN0000076323 CAGAGAAATCCTATCTTGAAA pLKO.1 1940 3UTR 100% 5.625 3.375 N Bco1 n/a
5 TRCN0000076327 GAAGCCATATCGCTACATCTT pLKO.1 1411 CDS 100% 4.950 2.970 N Bco1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15860 pDONR223 0% 81% 82.5% None (many diffs) n/a
2 ccsbBroad304_15860 pLX_304 0% 81% 82.5% V5 (many diffs) n/a
3 TRCN0000481081 GAGACCCAGAGGGCCAACGCAGAT pLX_317 28.8% 81% 82.5% V5 (many diffs) n/a
4 ccsbBroadEn_08350 pDONR223 100% 81% 82.5% None (many diffs) n/a
5 ccsbBroad304_08350 pLX_304 0% 81% 82.5% V5 (many diffs) n/a
6 TRCN0000481483 CATGCGCTACTTAATTGAAGTGCC pLX_317 29.7% 81% 82.5% V5 (many diffs) n/a
Download CSV