Transcript: Mouse NM_021503.2

Mus musculus myozenin 2 (Myoz2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myoz2 (59006)
Length:
1153
CDS:
182..976

Additional Resources:

NCBI RefSeq record:
NM_021503.2
NBCI Gene record:
Myoz2 (59006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098478 GCGGGATTACAGGAGCTTTAA pLKO.1 718 CDS 100% 13.200 18.480 N Myoz2 n/a
2 TRCN0000098477 GATAGAAGAATTGTCCCATTT pLKO.1 310 CDS 100% 10.800 15.120 N Myoz2 n/a
3 TRCN0000098479 TGCGGGATTACAGGAGCTTTA pLKO.1 717 CDS 100% 10.800 7.560 N Myoz2 n/a
4 TRCN0000098476 CTGACAAATACACCTTTGAAA pLKO.1 375 CDS 100% 5.625 3.938 N Myoz2 n/a
5 TRCN0000098475 CCACAGGAAGTTCTGCACATA pLKO.1 994 3UTR 100% 4.950 3.465 N Myoz2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03383 pDONR223 100% 87.1% 88.2% None (many diffs) n/a
2 ccsbBroad304_03383 pLX_304 0% 87.1% 88.2% V5 (many diffs) n/a
3 TRCN0000491345 TACATGACAATGTCCTTATCGTGT pLX_317 35% 87.1% 88.2% V5 (many diffs) n/a
4 ccsbBroadEn_15857 pDONR223 0% 86.9% 88.2% None (many diffs) n/a
5 ccsbBroad304_15857 pLX_304 0% 86.9% 88.2% V5 (many diffs) n/a
6 TRCN0000480033 GAATAAAAGGAACACGTGTTTGCG pLX_317 45.4% 86.9% 88.2% V5 (many diffs) n/a
Download CSV