Transcript: Mouse NM_021509.5

Mus musculus monooxygenase, DBH-like 1 (Moxd1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Moxd1 (59012)
Length:
3083
CDS:
88..1929

Additional Resources:

NCBI RefSeq record:
NM_021509.5
NBCI Gene record:
Moxd1 (59012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021509.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076332 CCTTCAACAAGCTCGTTCTTA pLKO.1 1694 CDS 100% 5.625 7.875 N Moxd1 n/a
2 TRCN0000076331 CGGTTACTGAATCCTGAGAAA pLKO.1 595 CDS 100% 4.950 6.930 N Moxd1 n/a
3 TRCN0000076329 CCGTACTTTGATCTGGTAAAT pLKO.1 640 CDS 100% 13.200 9.240 N Moxd1 n/a
4 TRCN0000076328 GCACATCAAGTGGAAAGCAAA pLKO.1 2192 3UTR 100% 4.950 3.465 N Moxd1 n/a
5 TRCN0000076330 GCCAAATGTTTAAGATTCCTA pLKO.1 701 CDS 100% 3.000 2.100 N Moxd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021509.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488119 TAGTATTCGCCAATATCTCACGGC pLX_317 18.1% 74.8% 76.7% V5 (many diffs) n/a
2 TRCN0000488239 CGGAGTATGCGCATCATACGGTCA pLX_317 20.7% 74.5% 76.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV