Transcript: Mouse NM_021525.2

Mus musculus RNA terminal phosphate cyclase-like 1 (Rcl1), mRNA.

Source:
NCBI, updated 2019-02-07
Taxon:
Mus musculus (mouse)
Gene:
Rcl1 (59028)
Length:
1803
CDS:
131..1252

Additional Resources:

NCBI RefSeq record:
NM_021525.2
NBCI Gene record:
Rcl1 (59028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313641 GGCGTACTCAGTTCGTGTATC pLKO_005 712 CDS 100% 10.800 15.120 N Rcl1 n/a
2 TRCN0000102448 GCTAATGACCTGCGTTGGTAT pLKO.1 1198 CDS 100% 4.950 6.930 N Rcl1 n/a
3 TRCN0000317215 GCTAATGACCTGCGTTGGTAT pLKO_005 1198 CDS 100% 4.950 6.930 N Rcl1 n/a
4 TRCN0000102449 CCGGTCAAGATCCGCAGGATT pLKO.1 215 CDS 100% 1.650 2.310 N Rcl1 n/a
5 TRCN0000102446 CCGTTTATGAAACACCCATTA pLKO.1 449 CDS 100% 10.800 8.640 N Rcl1 n/a
6 TRCN0000102447 CCAAACAGGAACAACCTTATA pLKO.1 331 CDS 100% 13.200 9.240 N Rcl1 n/a
7 TRCN0000313692 CTTTGCCTGGCTCCGTTTATG pLKO_005 437 CDS 100% 13.200 9.240 N Rcl1 n/a
8 TRCN0000102445 CCTCTTAACATTACAGACTTT pLKO.1 1350 3UTR 100% 4.950 3.465 N Rcl1 n/a
9 TRCN0000313691 CCTCCGTGGCATTGGCTATTA pLKO_005 403 CDS 100% 13.200 7.920 N Rcl1 n/a
10 TRCN0000313690 TGTGGCTCTGTGTAGGGTTTA pLKO_005 1556 3UTR 100% 10.800 6.480 N Rcl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02339 pDONR223 100% 88.6% 97% None (many diffs) n/a
2 ccsbBroad304_02339 pLX_304 0% 88.6% 97% V5 (many diffs) n/a
3 TRCN0000467913 ATATATCGTAAGAGCATTCGAGTT pLX_317 32.7% 88.6% 97% V5 (many diffs) n/a
Download CSV