Transcript: Mouse NM_021546.3

Mus musculus N-terminal EF-hand calcium binding protein 3 (Necab3), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Necab3 (56846)
Length:
1810
CDS:
15..1076

Additional Resources:

NCBI RefSeq record:
NM_021546.3
NBCI Gene record:
Necab3 (56846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120005 CCTCTGATACAGGGCGGAGTT pLKO.1 619 CDS 100% 1.350 1.890 N Necab3 n/a
2 TRCN0000120004 CCTGGTGGATTATGAATAATA pLKO.1 1051 CDS 100% 15.000 12.000 N Necab3 n/a
3 TRCN0000054081 CTGTATGAGTTCTGGCAGGAT pLKO.1 918 CDS 100% 2.640 2.112 N NECAB3 n/a
4 TRCN0000120003 GACCAGTTTGTCACACGATTT pLKO.1 399 CDS 100% 10.800 7.560 N Necab3 n/a
5 TRCN0000120002 GCCTATCATTTGCATGTCTTA pLKO.1 1625 3UTR 100% 4.950 3.465 N Necab3 n/a
6 TRCN0000120006 TCGTGCTTTGTGCTGCTACAT pLKO.1 824 CDS 100% 4.950 3.465 N Necab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14241 pDONR223 100% 84.3% 7.6% None (many diffs) n/a
2 ccsbBroad304_14241 pLX_304 0% 84.3% 7.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481233 CCATCTCGTGTCTATCCTCCGCCG pLX_317 35.6% 84.3% 7.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV