Transcript: Mouse NM_021548.4

Mus musculus cAMP-regulated phosphoprotein 19 (Arpp19), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arpp19 (59046)
Length:
4032
CDS:
186..524

Additional Resources:

NCBI RefSeq record:
NM_021548.4
NBCI Gene record:
Arpp19 (59046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250797 CTAGGTGAGTAGGGCTAATAA pLKO_005 1960 3UTR 100% 15.000 21.000 N Arpp19 n/a
2 TRCN0000250793 CGGATAAGACAGAGGTCACTG pLKO_005 430 CDS 100% 4.050 3.240 N Arpp19 n/a
3 TRCN0000250795 CAAGCTGGCTGGCTGATTAAA pLKO_005 509 CDS 100% 15.000 10.500 N Arpp19 n/a
4 TRCN0000216420 GTAATGAGCAAACGAATTATT pLKO.1 2396 3UTR 100% 15.000 10.500 N Arpp19 n/a
5 TRCN0000250794 GGAAATGGAAGATAAAGTAAC pLKO_005 230 CDS 100% 10.800 7.560 N Arpp19 n/a
6 TRCN0000179619 GTAACTAGTCCAGAGAAAGCT pLKO.1 246 CDS 100% 0.000 0.000 N Arpp19 n/a
7 TRCN0000250796 CAAAGTTAAAGGCAAGGTATC pLKO_005 274 CDS 100% 6.000 3.600 N Arpp19 n/a
8 TRCN0000178883 CAGAGAAAGCTGAAGAAGCAA pLKO.1 256 CDS 100% 3.000 1.800 N Arpp19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14055 pDONR223 100% 90.8% 98.2% None (many diffs) n/a
2 ccsbBroad304_14055 pLX_304 0% 90.8% 98.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475757 ATTATTGTCCTGCGTTTGCATAGG pLX_317 65.2% 90.8% 98.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV