Transcript: Human NM_021570.4

Homo sapiens BARX homeobox 1 (BARX1), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
BARX1 (56033)
Length:
1511
CDS:
210..974

Additional Resources:

NCBI RefSeq record:
NM_021570.4
NBCI Gene record:
BARX1 (56033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016478 CGGCCCAAGAAGAACTCAATT pLKO.1 855 CDS 100% 13.200 9.240 N BARX1 n/a
2 TRCN0000016481 GAAACGCTTCGAGAAGCAGAA pLKO.1 683 CDS 100% 4.050 2.835 N BARX1 n/a
3 TRCN0000016479 CCGGACAGAATAGATCTTGCT pLKO.1 717 CDS 100% 2.640 1.848 N BARX1 n/a
4 TRCN0000016482 CGAGCAGCTTACTGAGCAGGA pLKO.1 884 CDS 100% 0.720 0.504 N BARX1 n/a
5 TRCN0000016480 CGGAGGATGAAGTGGAAGAAA pLKO.1 786 CDS 100% 5.625 2.813 Y BARX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12294 pDONR223 100% 39.3% 39.3% None 1_462del n/a
2 ccsbBroad304_12294 pLX_304 0% 39.3% 39.3% V5 1_462del n/a
3 TRCN0000465496 TTTCGGCCACACCAAGTTGAAAGT pLX_317 100% 39.3% 39.3% V5 1_462del n/a
Download CSV