Transcript: Mouse NM_021608.3

Mus musculus dynactin 5 (Dctn5), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dctn5 (59288)
Length:
1532
CDS:
94..642

Additional Resources:

NCBI RefSeq record:
NM_021608.3
NBCI Gene record:
Dctn5 (59288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090766 AGCTACTACCAGAAGTTTCTA pLKO.1 604 CDS 100% 5.625 4.500 N Dctn5 n/a
2 TRCN0000327179 AGCTACTACCAGAAGTTTCTA pLKO_005 604 CDS 100% 5.625 4.500 N Dctn5 n/a
3 TRCN0000090764 GACCTGGCAAATGTAAGAGTT pLKO.1 244 CDS 100% 4.950 3.960 N Dctn5 n/a
4 TRCN0000327108 GACCTGGCAAATGTAAGAGTT pLKO_005 244 CDS 100% 4.950 3.960 N Dctn5 n/a
5 TRCN0000116818 GCTGATGATTGACGTCACCAA pLKO.1 582 CDS 100% 2.640 2.112 N DCTN5 n/a
6 TRCN0000310295 AGACGGCATCTGGGAACAAAG pLKO_005 137 CDS 100% 10.800 7.560 N DCTN5 n/a
7 TRCN0000090763 GCTGCTAAGATGGGACCAATA pLKO.1 1226 3UTR 100% 10.800 7.560 N Dctn5 n/a
8 TRCN0000327105 GCTGCTAAGATGGGACCAATA pLKO_005 1226 3UTR 100% 10.800 7.560 N Dctn5 n/a
9 TRCN0000090765 GTCCTCAATGGCAAGACCATT pLKO.1 196 CDS 100% 0.495 0.347 N Dctn5 n/a
10 TRCN0000090767 AGCCAGAACATCGTCCTCAAT pLKO.1 184 CDS 100% 4.950 2.970 N Dctn5 n/a
11 TRCN0000327178 AGCCAGAACATCGTCCTCAAT pLKO_005 184 CDS 100% 4.950 2.970 N Dctn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04394 pDONR223 100% 92.1% 99.4% None (many diffs) n/a
2 ccsbBroad304_04394 pLX_304 0% 92.1% 99.4% V5 (many diffs) n/a
3 TRCN0000467642 AGCGCCGATTGAAAAGCCATGATG pLX_317 60.6% 92.1% 99.4% V5 (many diffs) n/a
Download CSV