Transcript: Human NM_021640.4

Homo sapiens chromosome 12 open reading frame 10 (C12orf10), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
C12orf10 (60314)
Length:
1202
CDS:
44..1174

Additional Resources:

NCBI RefSeq record:
NM_021640.4
NBCI Gene record:
C12orf10 (60314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021640.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152603 GAGTTGCTCGACTTAATCCTA pLKO.1 636 CDS 100% 3.000 4.200 N C12orf10 n/a
2 TRCN0000297998 GAGTTGCTCGACTTAATCCTA pLKO_005 636 CDS 100% 3.000 4.200 N C12orf10 n/a
3 TRCN0000152565 GAGGAGTTTCTGCAGAGATTA pLKO.1 719 CDS 100% 13.200 9.240 N C12orf10 n/a
4 TRCN0000292513 GAGGAGTTTCTGCAGAGATTA pLKO_005 719 CDS 100% 13.200 9.240 N C12orf10 n/a
5 TRCN0000158062 CCAGTGGCCATCTTCTTTGTT pLKO.1 899 CDS 100% 5.625 3.938 N C12orf10 n/a
6 TRCN0000101856 GACAAGATGTATGAGAACTTT pLKO.1 527 CDS 100% 5.625 3.938 N Myg1 n/a
7 TRCN0000316365 GACAAGATGTATGAGAACTTT pLKO_005 527 CDS 100% 5.625 3.938 N Myg1 n/a
8 TRCN0000101857 CTATGACAAGATGTATGAGAA pLKO.1 523 CDS 100% 4.950 3.465 N Myg1 n/a
9 TRCN0000156960 GCACCCTCTATGACAAGATGT pLKO.1 516 CDS 100% 4.950 3.465 N C12orf10 n/a
10 TRCN0000158348 CCAAGTGGAGAGATTGTGGAA pLKO.1 815 CDS 100% 2.640 1.848 N C12orf10 n/a
11 TRCN0000292512 CCAAGTGGAGAGATTGTGGAA pLKO_005 815 CDS 100% 2.640 1.848 N C12orf10 n/a
12 TRCN0000156934 GATATGACCATCACCAGAGGT pLKO.1 354 CDS 100% 2.640 1.848 N C12orf10 n/a
13 TRCN0000292435 GATATGACCATCACCAGAGGT pLKO_005 354 CDS 100% 2.640 1.848 N C12orf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021640.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08791 pDONR223 100% 99.6% 99.2% None 11_12delAAinsGC;1046C>T;1058A>G n/a
2 ccsbBroad304_08791 pLX_304 0% 99.6% 99.2% V5 11_12delAAinsGC;1046C>T;1058A>G n/a
3 TRCN0000465919 TCGTATGCGATTGTTCAACGGTCC pLX_317 27.3% 99.6% 99.2% V5 11_12delAAinsGC;1046C>T;1058A>G n/a
4 ccsbBroadEn_15956 pDONR223 0% 58.5% 58.2% None 1_465del;1046C>T;1058A>G n/a
5 ccsbBroad304_15956 pLX_304 0% 58.5% 58.2% V5 1_465del;1046C>T;1058A>G n/a
6 TRCN0000474858 GACTAGGCGATGGCCGGCGGTGTA pLX_317 68.9% 58.5% 58.2% V5 1_465del;1046C>T;1058A>G n/a
Download CSV