Transcript: Human NM_021649.7

Homo sapiens toll like receptor adaptor molecule 2 (TICAM2), mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TICAM2 (353376)
Length:
3203
CDS:
443..1150

Additional Resources:

NCBI RefSeq record:
NM_021649.7
NBCI Gene record:
TICAM2 (353376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021649.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359120 CCGTTAACAGGCAGCATAAAT pLKO_005 921 CDS 100% 15.000 7.500 Y TICAM2 n/a
2 TRCN0000359122 TGGTATCAAACCCGGAATAAT pLKO_005 754 CDS 100% 15.000 7.500 Y TICAM2 n/a
3 TRCN0000359121 GGTGTAATTTCCAGTTCTATA pLKO_005 885 CDS 100% 13.200 6.600 Y TICAM2 n/a
4 TRCN0000359123 TGTTAAGCGTTGATGCATATA pLKO_005 1645 3UTR 100% 13.200 6.600 Y TICAM2 n/a
5 TRCN0000056740 CCAGTTCTATACGTCCCTAAT pLKO.1 895 CDS 100% 10.800 5.400 Y TICAM2 n/a
6 TRCN0000056739 CGGAATAATCTTTGCTGAGAT pLKO.1 766 CDS 100% 4.950 2.475 Y TICAM2 n/a
7 TRCN0000056738 GCAAACTATTTACCCTCCTTT pLKO.1 2330 3UTR 100% 4.950 2.475 Y TICAM2 n/a
8 TRCN0000056741 CCTACACAAGTAGAAAGAATT pLKO.1 1049 CDS 100% 0.000 0.000 Y TICAM2 n/a
9 TRCN0000056742 GCAGACAGCATTTACAGAATT pLKO.1 795 CDS 100% 0.000 0.000 Y TICAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021649.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05528 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05528 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469430 CAGGCAAAGTTGCAGGTTTTCTTA pLX_317 55.4% 100% 100% V5 n/a
Download CSV