Transcript: Human NM_021810.6

Homo sapiens cadherin 26 (CDH26), transcript variant b, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CDH26 (60437)
Length:
2494
CDS:
198..695

Additional Resources:

NCBI RefSeq record:
NM_021810.6
NBCI Gene record:
CDH26 (60437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021810.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053861 GACTCCGTTTGAGGAAATATA pLKO.1 650 CDS 100% 15.000 10.500 N CDH26 n/a
2 TRCN0000289928 GACTCCGTTTGAGGAAATATA pLKO_005 650 CDS 100% 15.000 10.500 N CDH26 n/a
3 TRCN0000296407 AGGATGAGGACACACTATTAG pLKO_005 812 3UTR 100% 13.200 9.240 N CDH26 n/a
4 TRCN0000053859 GCTGGACTCTTTGGGTTCAAA pLKO.1 626 CDS 100% 5.625 3.938 N CDH26 n/a
5 TRCN0000289852 GCTGGACTCTTTGGGTTCAAA pLKO_005 626 CDS 100% 5.625 3.938 N CDH26 n/a
6 TRCN0000053860 GCAAGCCCTTTGAGCCAAGAA pLKO.1 370 CDS 100% 4.950 3.465 N CDH26 n/a
7 TRCN0000053862 CCTCACGTCTACAGCGAGGAA pLKO.1 537 CDS 100% 0.880 0.616 N CDH26 n/a
8 TRCN0000053858 GCAGAGACATTGAATCAGAAA pLKO.1 474 CDS 100% 4.950 2.970 N CDH26 n/a
9 TRCN0000289853 GCAGAGACATTGAATCAGAAA pLKO_005 474 CDS 100% 4.950 2.970 N CDH26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021810.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12424 pDONR223 100% 75.1% 75.1% None 97_219del n/a
2 ccsbBroad304_12424 pLX_304 0% 75.1% 75.1% V5 97_219del n/a
3 TRCN0000479718 CTGGCATGCTAACCAAGTACACGC pLX_317 88% 75.1% 75.1% V5 97_219del n/a
Download CSV