Transcript: Mouse NM_021921.3

Mus musculus mitogen-activated protein kinase 8 interacting protein 2 (Mapk8ip2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mapk8ip2 (60597)
Length:
3553
CDS:
311..2803

Additional Resources:

NCBI RefSeq record:
NM_021921.3
NBCI Gene record:
Mapk8ip2 (60597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088651 CCCTATTTGTTCCTTCCAAGA pLKO.1 517 CDS 100% 4.050 3.240 N Mapk8ip2 n/a
2 TRCN0000088648 GCCCTTCTCTTGTGATTTATA pLKO.1 3190 3UTR 100% 15.000 10.500 N Mapk8ip2 n/a
3 TRCN0000088650 GCTGGTGTACGATGCAGTTAA pLKO.1 1837 CDS 100% 13.200 9.240 N Mapk8ip2 n/a
4 TRCN0000362725 ATAACAACAACGGAGGCTTTA pLKO_005 771 CDS 100% 10.800 7.560 N Mapk8ip2 n/a
5 TRCN0000368846 GCGCATGATCTCGTCCATTTC pLKO_005 1114 CDS 100% 10.800 7.560 N Mapk8ip2 n/a
6 TRCN0000088649 CCAAGATGATTTCCAGGAGTT pLKO.1 532 CDS 100% 4.050 2.835 N Mapk8ip2 n/a
7 TRCN0000088652 GCCACACCCTATTTGTTCCTT pLKO.1 511 CDS 100% 3.000 2.100 N Mapk8ip2 n/a
8 TRCN0000037993 CAAGAAGTTCCTCAATGTCTT pLKO.1 2047 CDS 100% 4.950 2.970 N MAPK8IP2 n/a
9 TRCN0000362726 GGATGACACCAACAGCGAATA pLKO_005 1300 CDS 100% 10.800 5.400 Y Mapk8ip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11744 pDONR223 100% 47.4% 50.6% None (many diffs) n/a
2 ccsbBroad304_11744 pLX_304 0% 47.4% 50.6% V5 (many diffs) n/a
3 TRCN0000471059 AACAGATTTCATCTCAGGATACAG pLX_317 27.3% 47.4% 50.6% V5 (many diffs) n/a
Download CSV